5.13 class
From Biolecture.org
what is life? I think life is repetition.
Simple vs Complex?
I think it does not have any criteria. Because 1 human is simple, but 1 human is composed of many cells and it is complex.
-> person is simple, but it is complex because it composed of cells. Cell is simple, but it is complex because it composed of many organelles. Nucleus is simple, but it is complex because it composed of many DNA nucleotides. And it composed of bases. Therefore, I think Simple is Complex...
FASTA - https://en.wikipedia.org/wiki/FASTA
HW!!!! : Using Perl!!!!!
(1) ATGCGACTGACTGACTAGCTAG -> Transfer DNA seq into aminoacids seq
(2) Predict protein 3D structure by seeing amino acids sequence only.