Changes
no edit summary
<span style="WIDOWS: 2p> TEXT-TRANSFORM: none; TEXT-INDENT: 0px; BORDER-COLLAPSE: separate; FONT: 16px 'Times New Roman'; WHITE-SPACE: normal</p> <p><strong>Obese in Genomics</strong></p> <p> ORPHANS: 2; LETTER-SPACING: normal; COLOR: rgb(0,0,0); WORD</p> <p><strong>What is Obese?</strong></p> <div>-SPACINGObesity is a <a href="https: 0px; -webkit-border-horizontal-spacing: 0px; -webkit-border-vertical-spacing: 0px; -webkit-text-decorations-//en.wikipedia.org/wiki/Medical_condition">medical condition</a> in-effectwhich excess <a href="https: none; -webkit-text-size-adjust: auto; -webkit-text-stroke-width: 0px" class="Apple-style-span//en.wikipedia.org/wiki/Body_fat">body fat<span style="LINE-HEIGHT: 14px; FONT-FAMILY: Verdana/a> has accumulated to the extent that it may have a negative effect on health.</div> <div> FONT-SIZE: 12px" class="Apple-style-span"><br /div> <span style=div>-People are generally considered obese when their <a href="WIDOWShttps: 2//en.wikipedia.org/wiki/Body_mass_index">body mass index</a> (BMI), a measurement obtained by dividing a person' TEXT-TRANSFORM: nones weight by the square of the person' TEXT-INDENT: 0pxs height, is over 30 BORDER-COLLAPSE<a href="https: separate; FONT//en.wikipedia.org/wiki/Kilogram">kg</a>/<a href="https: 16px 'Times New Roman'; WHITE-SPACE: normal; ORPHANS//en.wikipedia.org/wiki/Square_metre">m</a><a href="https: //en.wikipedia.org/wiki/Square_metre">2; LETTER-SPACING: normal; COLOR: rgb(0</a> ,0,0)with the range 25– WORD-SPACING: 0px30 -webkit-border-horizontal-spacing<a href="https: 0px; -webkit-border-vertical-spacing: 0px; -webkit-text-decorations-in-effect: none; -webkit-text-size-adjust: auto; -webkit-text-stroke-width: 0px" class="Apple-style-span//en.wikipedia.org/wiki/Kilogram">kg<span style/a>/<a href="TEXT-ALIGNhttps: right; FONT-FAMILY: Verdana; FONT-SIZE: 12px" class="Apple-style-span//en.wikipedia.org/wiki/Square_metre">m</a><span style=a href="VERTICAL-ALIGNhttps: top" title="PLoS pathogens//en.wikipedia.org/wiki/Square_metre">2</a> defined as <a style="VERTICAL-ALIGN: top" href="javascripthttps:AL_get(this, 'jour', 'PLoS Pathog//en.wikipedia.');"><font color="#0066ccorg/wiki/Overweight">PLoS Pathog.</font>overweight</a></spandiv> <span class="Apple-converted-space"div> </spandiv>2009 May;5(5) <div>-Obesity increases the likelihood of <a href="https:e1000446//en. Epub 2009 May 29<br wikipedia.org/><wiki/spanObesity-associated_morbidity">various diseases</spana>, particularly <span stylea href="WIDOWShttps: 2; TEXT-TRANSFORM: none; TEXT-INDENT: 0px; BORDER-COLLAPSE: separate; FONT: 16px 'Times New Roman'; WHITE-SPACE: normal; ORPHANS//en.wikipedia.org/wiki/Cardiovascular_diseases">heart disease</a>, <a href="https: //en.wikipedia.org/wiki/Diabetes_mellitus_type_2">type 2; LETTER-SPACING: normal; COLOR: rgb(0diabetes</a>,0,0); WORD-SPACING<a href="https: 0px; -webkit-border-horizontal-spacing//en.wikipedia.org/wiki/Obstructive_sleep_apnea">obstructive sleep apnea</a>, certain types of <a href="https: 0px; -webkit-border-vertical-spacing: 0px; -webkit-text-decorations-in-effect: none; -webkit-text-size-adjust: auto; -webkit-text-stroke-width: 0px" class="Apple-style-span"//en.wikipedia.org/wiki/Cancer">cancer</a>, and <span stylea href="FONT-FAMILYhttps: Verdana; FONT-SIZE: 14px" class="Apple-style-span//en.wikipedia.org/wiki/Osteoarthritis">osteoarthritis</a>.</div> <div style="PADDING-BOTTOM: 0px> MARGIN: 0px 0px 0.5em 0.5em; PADDING</div> <div>-LEFT: 0px; PADDING-RIGHT: 0px; FONT-SIZE: 12px; PADDING-TOP: 0px" class="authors">Obesity is most commonly caused by a combination of excessive <a stylehref="FONT-WEIGHThttps: bold//en.wikipedia.org/wiki/Food_energy" >food</a> intake, lack of physical activity, and <a href="httphttps://genomicsen.wikipedia.org/siteswiki/entrez?Db=pubmed&Cmd=Search&Term=%22Ollomo%20B%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus"Polygenic_inheritance">genetic susceptibility</a>.</div> <strongdiv> <font color="#0066cc"/div>Ollomo B </fontdiv><p> </p> <p><strong>Arrangement of basic terms in Genomics</strong></ap>, <span class="Apple-converted-space"p> </spanp> <p><strong>What is Genomics?</strong></p></div> <p>Genomics is the <a style="FONT-WEIGHT: bold" href="http://genomicsbiopedia.org/sitesindex.php/entrez?Db=pubmed&Cmd=Search&Term=%22Durand%20P%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlusOmics">omics<strong/a>study of <font colora href="#0066cc">Durand P<http:/font></strongbiopedia.org/index.php/Gene">genes</a>of individual organisms,<span class="Apple-converted-space"> </span>populations, and <a style="FONT-WEIGHT: bold" href="http://genomicsbiopedia.org/sitesindex.php/entrez?Db=pubmed&Cmd=Search&Term=%22Prugnolle%20F%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus">Species">species<strong/a><font color="#0066cc">Prugnolle F.</fontp> </strongp>Paradigm of performing biological science that deviates from investigating single genes, their functions, and roles.</ap>, <span class="Apple-converted-space"p> </spanp> <p><a style="FONT-WEIGHT: bold" href="http:strong>What is Omics?</strong></genomics.orgp> <p>General term for a broad discipline of science and engineering</sites/entrez?Db=pubmedp> <p>Analyzing the interactions of biological information objects in various&nbsp;Cmd<a href=Search&Term"http://omics.org/index.php?title=%22Douzery%20E%22%5BAuthor%5DOmes&itoolaction=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlusedit">omes<strong/a>in biology<font color="#0066cc"/p> <p>Douzery E</fontstrong>Main focus</strong></ap>, <span class="Apple-converted-space"div> 1)mapping information objects such as genes and proteins</spandiv> <div><strong><u>2)finding interaction relationships among the objects<a style="FONT-WEIGHT: bold" href="http:/u></genomics.orgstrong></sites/entrez?Db=pubmed&Cmd=Search&Term=%22Arnathau%20C%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus"div> <div>3)engineering the networks and objects to understand and manipulate the regulatory mechanisms<strong/div> <font color="#0066cc"div>Arnathau C </fontdiv> </strong></a>,<span class="Apple-converted-space"div> </spandiv> <div><strong>What is Proteomics?<a style="FONT-WEIGHT: bold" href="http:/strong></genomics.org/sites/entrez?Db=pubmeddiv> <div>&nbsp;Cmd=Search</div> <div><p>Omics study of&nbsp;Term=%22Nkoghe%20D%22%5BAuthor%5Dproteins, particularly their structures, sequences,&nbsp;itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPaneland functions.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus"><strong/p> <font color="#0066cc"p>Nkoghe D (which proteins interact)</fontp> </strong></a>,<span class="Apple-converted-space"p> </spanp> <a style="FONT-WEIGHT: bold" href="http://genomicsp>The set of proteins produced by it during its life, and its genome is its set of genes.org</sites/entrez?Db=pubmedp> <p>&nbsp;Cmd=Search&Term=%22Leroy%20E%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus"</p> <strongp><font color="#0066cc">Leroy EA proteome differs from cell to cell and constantly changes through its biochemical interactions with the genome and the environment.</fontp> </strongp>=> One organism has radically different protein expression in different parts of its body, different stages of its life cycle and different environmental conditions</ap>, <span class="Applep>*There are far fewer protein-converted-space">coding genes in the human genome than proteins in the human proteome (20,000 to 25,000 genes vs.  gt;500,000 proteins)</spanp> <a stylep>="FONT-WEIGHT: bold" href="http:> Protein diversity is thought to be due to alternative splicing and post-translational modification of proteins<//genomics.org/sites/entrez?Db=pubmedp> <p>&nbsp;Cmd=Search&Term=%22Renaud%20F%22%5BAuthor%5D&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DiscoveryPanel.Pubmed_RVAbstractPlus"</p> <strongp>New methods include protein microarrays, <font color="#0066cc"u>Renaud F</fontstrong>immunoaffinity chromatography followed by mass spectrometry(MALDI-TOF mass spectrometry),</strong></au>.and combinations of experimental methods such as phage display and computational methods.</divp> <p style="LINE-HEIGHT: 1.2em; MARGIN: 1em 0px 0.5em 0.5em; FONT-SIZE: 11px; PADDING-TOP: 0px" class="affiliation">Uniténbsp; des Maladies Virales Emergentes, Centre International de Recherches Médicales de Franceville, Franceville, Gabon.<//p> <p></spanstrong>What is Metabolome?</spanstrong><br /p> <br /p>Researchers reported the discovery of a new Plasmodium species infecting Hominids. <br /p>New species has been isolated in two chimpanzees (Pan troglodytes) kept as pets by villagers in Gabon (Africa).<p>Interaction between an organism rsquo;s genome and its environment<br /p> <br p> </p>Analysis <p>Complete set of its complete mitochondrial genome (5529 nucleotides including Cyt b, Cox I and Cox III genes) reveals an older divergence of this lineage from the clade that includes [[P<a href="https://en. falciparum]] and [[Pwikipedia. reichenowi]] (approximately 21+org/wiki/Small_molecule">small-9 Myrs ago using Bayesian methods and considering that the divergence between P. falciparum and P. reichenowi occurred 4 to 7 million years ago as generally considered in the literature)molecule</a> chemicals found within a biological sample.</p> <p> <br /p>This time frame would be congruent with the radiation of hominoids, suggesting that this Plasmodium lineage might have been present in early hominoids and that they may both have experienced <p>The <a simultaneous diversificationhref="https://en.<br wikipedia.org/wiki/Small_molecule">small molecule<br /a>chemicals found in a given metabolome may include both endogenous <a href="httphttps://wwwen.ncbiwikipedia.nlm.nih.govorg/pubmedwiki/19478877?ordinalpos=1&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DefaultReportPanel.Pubmed_RVDocSumMetabolites">metabolites</a> that are naturally produced by an <font colora href="#0066cc">httphttps://wwwen.ncbiwikipedia.nlm.nih.govorg/pubmedwiki/19478877?ordinalpos=1Organism">organism</a> as well as exogenous chemicals</p> <p>&nbsp;itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DefaultReportPanel.Pubmed_RVDocSum</fontp> </ap><br /strong>The endogenous metabolome</spanstrong></p> <p>-> primary metabolome</p> <p>-> Secondary metabolome</p> <p> </p> <p><a href="https://en.wikipedia.org/wiki/Primary_metabolite">* primary metabolite</a> is directly involved in the normal growth, development, and reproduction.</p> <p><a href="https://en.wikipedia.org/wiki/Secondary_metabolite">*secondary metabolite</a> is not directly involved in those processes, but usually has important ecological function(ex: <a href="https://en.wikipedia.org/wiki/Pigments">pigments</a>, <a href="https://en.wikipedia.org/wiki/Antibiotics">antibiotics</a> or waste products derived from partially metabolized <a href="https://en.wikipedia.org/wiki/Xenobiotics">xenobiotics</a>)</p> <p><a href="https://en.wikipedia.org/wiki/NMR_spectroscopy">Use NMR spectroscopy</a> and <a href="https://en.wikipedia.org/wiki/Mass_spectrometry">mass spectrometry</a>.</p> <p> </p> <p> </p> <p><strong>The Human Metabolome Database</strong></p> <p> </p> <p>Contain detailed data on more than 40,000 metabolites that have already been identified or are likely to be found in the human body</p> <p> </p> <div>1)Chemical information</div> <p>- includes >40,000 metabolite structures with detailed descriptions, extensive chemical classifications, synthesis information and observed/calculated chemical properties</p> <div> </div> <div>2)Clinical information</div> <p>- includes data on >10,000 <a href="https://en.wikipedia.org/wiki/Metabolite">metabolite</a>-<a href="https://en.wikipedia.org/wiki/Biofluid">biofluid</a> concentrations, metabolite concentration information on more than 600 different human diseases and pathway data for more than 200 different inborn errors of metabolism.</p> <div> </div> <div> </div> <div>3)Biochemical information.</div> <p>- includes nearly 6000 protein (and DNA) sequences and more than 5000 biochemical reactions that are linked to these metabolite entries</p></div> <p> </p> <p>---------------------------------------------</p> <p>Obese</p> <p> </p> <p>-> Mainly Influenced by External effects!</p> <p>-> The Disease that can be cured!</p> <p>-> Obese parents usually have obese children!</p> <p> </p> <p><strong><u>Therefore, Focus more on protemoics, Metabolome!</u></strong></p> <p> -----------------------------------------------------------------------</p> <p><strong><spanstyle="font-size:14px">Adipose tissue</span></strong></p> <p> </p> <p><strong>-> Adipokine </strong></p> <p> -> <span style="font-size:12px"><span style="color:black; font-family:맑은 고딕">Adipose tissue secreted multiple mediator</span></span></p> <p><span style="font-size:12px"><span style="color:black; font-family:맑은 고딕"> </span></span>-> Passed through either endocrine or paracrine</p> <p> Ex: Hormone: leptin, adiponectin</p> <p> </p> <p><strong>-> Adiponectin</strong></p> <p><strong> -> </strong>Adipocyte-secreted adipokine</p> <p> -> Increase lipid oxidation& anti-inflammatory, insulin-sensitizing, angiogenic action</p> <p> <strong>=> Anti obesity & Antidiabetic, Decrease insulin resistance </strong></p> <p> [[File:1.png|400px]]</p> <p> </p> <p> </p> <p> [[File:2.gif|400px]]</p> <p>-> Illustration of the major physiological and metabolic</p> <p>processes with which adipose tissue is involved through the secretion</p> <p>of various adipokines from adipocytes. The interactions may be</p> <p>autocrine, paracrine, or endocrine.</p> <p> </p> <p><span style="font-size:16px"><strong><Searching Scientific Reports></strong></span></p> <p> [[File:3.png|400px]]</p> <p> [[File:4.png|400px]]</p> <p> </p> <p><strong><span style="font-size:16px"><What is Col6?></span></strong></p> <p>- COL6 = Collagen type 6</p> <p>- Abundant constituent of white adipose tissue (WAT)</p> <p>- COL6 levels positively correlate with hyperglycaemia and insulin resistance</p> <p>- Composed of three distinct a chains, a1, a2 and a3.(COL6 trimeric building block) and are subsequently secreted into the ECM</p> <p> </p> <p><strong><span style="font-size:16px"><What is a3 Chain?></span></strong></p> <p>-> longest of the three chains</p> <p>- contains an unusually long N terminus and a globular C5 domain at the C-terminus</p> <p> </p> <p>-> C-terminal portion of the a3 subunit is cleaved off during the post-translational processing of COL6 fibrils(COL6a3, Endotrophin)</p> <p> </p> <p><strong><span style="font-size:16px"><What is Endotrophin?></span></strong></p> <p>- Adipokine with potent tumour-promoting effects</p> <p>- Plays a pivotal role in shaping a metabolically unfavorable microenvironment in adipose tissue during consumption of a high-fat diet (HFD)</p> <p>- Powerful co-stimulator of pathologically relevant pathways within the ‘unhealthy’ adipose tissue milieu, triggering fibrosis and inflammation and ultimately leading to enhanced insulin resistance& metabolic dysfunction.</p> <p>- Exerts a major influence in adipose tissue</p> <p>- Endotrophin within the tumor microenvironment serves as a major mediator of COL6-stimulated mammary tumor growth and subsequent chemo resistance</p> <p>- Stimulates fibrosis, activates endothelial cell migration and promotes macrophage infiltration into growing solid tumors.</p> <p>=> elevated mammary tumor expansion and more pronounced metastatic growth</p> <p> [[File:5.png|400px]]</p> <p>---------------------------------------------------------</p> <p><u><strong><span style="font-size:18px">Problem!</span></strong></u></p> <p> </p> <p><strong>-> Don’t know the mechanism of how ETP works.</strong></p> <p> </p> <p><u><strong><span style="font-size:16px">What I’m going to do!</span></strong></u></p> <p> </p> <div><strong>-> Find the Receptor according to the New method of Protemoics.</strong></div> <div><strong>-> Find the interaction, relationship and mechanisms how they act.(Study of Omics)</strong></div> <div><u><strong> -> Omics could be applied to genomics perspective!</strong></u></div> <p> </p> <p> </p> <p>mETP(204bp, 16.43kda)</p> <p>ACAGAACCATTGTTTCTCACTAAAACAGATATATGTAAGCTGTCCAGAGATGCTGGGACTT</p> <p>GTGTGGACTTCAAGTTACTATGGCACTATGACCTAGAGAGCAAAAGTTGCAAGAGATTCTG</p> <p>GTATGGAGGTTGTGGAGGCAACGAGAACAGATTCCACTCCCAGGAAGAATGTGAAAAGATGTGTAGTCCTGAGTTAACAGTT</p> <p> </p> <p>SpyTag(39bp, 16.43kda)</p> <p>GCCCACATCGTGATGGTGGACGCCTACAAGCCGACGAAG</p> <p> </p> <p>pRL(90bp, 7.48kda)</p> <p>ATGGACAGCAAAGGTTCGTCGCAGAAAGGGTCCCGCCTGCTCCTGCTGCTGGTGGTGTCAAATCTACTCTTGTGCCAGGGTGTGGTCTCC</p> <p> </p> <p>(1)</p> <p> [[File:12.png|600px]]</p> <p> pRA-GFP-EcoR1-pRL-unknown-mETP-SpyTag-Stop</p> <p> </p> <p>-><strong> How to make this cloning?</strong></p> <p>(1)By Using pRL-EcoR1 forward primer, mETP-SpyTag-Stop-Xho1 primer, make pRL-EcoR1-mETP-SpyTag-Stop-Xho1 by Ex-Tag PCR</p> <p>[[File:13.png|500px]]</p> <p>(2) Insert template gained from (1) in T-Vector to check whether it is really pRL-EcoR1-mETP-SpyTag-Stop-Xho1 or not.</p> <p>(3) Use EcoR1, Xho1 Digestion enzyme to double digest T vector</p> <p>(4) Double Digest pRA GFP vector(empty vector) and purify it.</p> <p>(5) ligate (3), (4) product</p> <p> </p> <p><strong>-> Detailed on Each Steps</strong></p> <p>(1) Ex-Tag PCR process</p> <p> </p> <p>->Template(pRA-GFP, 20ng): 1ul</p> <p>->Primer: 1,1ul</p> <p>->dNTP(10nM): 1ul</p> <p>->10X Ex-Tag Buffer: 2.5ul</p> <p>-> Ex-Tag polymerase: 1ul</p> <p>-> D.W: 17.5ul</p> <p>----------------------------------------</p> <p>Total: 25ul</p> <p> </p> <p>PCR</p> <p>->Temperature Gradient : 54,56,58</p> <p>->98 celsius : 2min</p> <p>->98 celsius : 10sec</p> <p>->57 celsius : 30sec</p> <p>->72 celsius : 30sec(insert 300bp)</p> <p>->72 celsius : 5min</p> <p>X35</p> <p> [[File:14.png|400px]]</p> <p>-> Can see the insert(300bp) in both 54,56,58 temperature gradient!</p> <p> </p> <p> (2)</p> <p><T vector ligation></p> <p>Insert DNA mass: 8.607ng(3:1)</p> <p>2X Rapid ligation: 5ul</p> <p>T vector: 0.5ul(25ng)</p> <p>PCR product: 1ul(8.7ng)</p> <p>D.W: 2.5ul</p> <p>T4 DNA Ligase: 1ul</p> <p>----------------------------</p> <p>Total: 10ul</p> <p>RT 1 hour incubation</p> <p>Then, Transformation</p> <p> </p> <p><Colony PCR></p> <p>-> Check whether insert base pairs is inserted in T vector well</p> <p>T.D.W : 14.9</p> <p>10X Buffer : 2</p> <p>M13 primer Forward: 0.5</p> <p>M13 primer Reverse: 0.5</p> <p>2.5mM dNTP: 1.6</p> <p>XL-Taq polymerase: 0.5</p> <p> ---------------------------------</p> <p>[[File:15.jpg|400px]]</p> <p>Can check on 3,5 well(T vector 200bp+ 346bp = 500~600bp)</p> <p> </p> <p> (3)</p> <p> </p> <p> </p> <p>------------------------------------------------------------</p> <p>[[20131571 조우빈]]</p>