Changes

From Biolecture.org

Essay !6 - About BLAST Code: KSI0006

7,111 bytes added, 00:57, 28 November 2016
no edit summary
<pstyle="text-align: center;">asd<span style="font-size:26px">Essay 6 - About the Blast and BLAT.</span></p> <p>In&nbsp;<a href="https://en.wikipedia.org/wiki/Bioinformatics" title="Bioinformatics">bioinformatics</a>,&nbsp;<strong>BLAST</strong>&nbsp;for&nbsp;<strong>B</strong>asic&nbsp;<strong>L</strong>ocal&nbsp;<strong>A</strong>lignment&nbsp;<strong>S</strong>earch&nbsp;<strong>T</strong>ool is an&nbsp;<a href="https://en.wikipedia.org/wiki/Algorithm" title="Algorithm">algorithm</a>&nbsp;for comparing&nbsp;<a href="https://en.wikipedia.org/wiki/Primary_structure" title="Primary structure">primary</a>&nbsp;biological sequence information, such as the&nbsp;<a href="https://en.wikipedia.org/wiki/Amino_acid" title="Amino acid">amino-acid</a>&nbsp;sequences of&nbsp;<a href="https://en.wikipedia.org/wiki/Protein" title="Protein">proteins</a>&nbsp;or the&nbsp;<a href="https://en.wikipedia.org/wiki/Nucleotide" title="Nucleotide">nucleotides</a>&nbsp;of&nbsp;<a href="https://en.wikipedia.org/wiki/DNA_sequence" title="DNA sequence">DNA sequences</a>. A BLAST search enables a researcher to compare a query sequence with a library or&nbsp;<a href="https://en.wikipedia.org/wiki/Database" title="Database">database</a>&nbsp;of sequences, and identify library sequences that resemble the query sequence above a certain threshold.</p> <p>I want to write&nbsp;about the <strong>BLAT</strong>&nbsp;(<a href="https://en.wikipedia.org/wiki/BLAST" title="BLAST">BLAST</a>-like alignment tool) is a&nbsp;<a href="https://en.wikipedia.org/wiki/Sequence_alignment" title="Sequence alignment">pairwise sequence alignment</a>&nbsp;<a href="https://en.wikipedia.org/wiki/Algorithm" title="Algorithm">algorithm</a>&nbsp;that was developed by&nbsp;<a href="https://en.wikipedia.org/wiki/Jim_Kent" title="Jim Kent">Jim Kent</a>&nbsp;at the&nbsp;<a href="https://en.wikipedia.org/wiki/University_of_California_Santa_Cruz" title="University of California Santa Cruz">University of California Santa Cruz</a>&nbsp;(UCSC) in the early 2000s to assist in the assembly and annotation of the&nbsp;<a href="https://en.wikipedia.org/wiki/Human_Genome" title="Human Genome">human genome</a>.<span style="font-size:10.8333px"> </span>It was designed primarily to decrease the time needed to align millions of mouse genomic reads and&nbsp;<a href="https://en.wikipedia.org/wiki/Expressed_sequence_tags" title="Expressed sequence tags">expressed sequence tags</a>&nbsp;against the human genome sequence. The alignment tools of the time were not capable of performing these operations in a manner that would allow a regular update of the human genome assembly. Compared to pre-existing tools, BLAT was ~500 times faster with performing&nbsp;<a href="https://en.wikipedia.org/wiki/MRNA" title="MRNA">mRNA</a>/<a href="https://en.wikipedia.org/wiki/DNA" title="DNA">DNA</a>&nbsp;alignments and ~50 times faster with&nbsp;<a href="https://en.wikipedia.org/wiki/Protein" title="Protein">protein</a>/protein alignments.</p> <p>BLAT is one of multiple algorithms developed for the analysis and comparison of biological sequences such as DNA, RNA and proteins, with a primary goal of inferring&nbsp;<a href="https://en.wikipedia.org/wiki/Homology_(biology)" title="Homology (biology)">homology</a>&nbsp;in order to discover biological function of genomic sequences.&nbsp;It is not guaranteed to find the mathematically optimal alignment between two sequences like the classic Needleman-Wunsch&nbsp;and Smith-Waterman&nbsp;<a href="https://en.wikipedia.org/wiki/Dynamic_programming" title="Dynamic programming">dynamic programming</a>&nbsp;algorithms do; rather, it first attempts to rapidly detect short sequences which are more likely to be homologous, and then it aligns and further extends the homologous regions. It is similar to the&nbsp;<a href="https://en.wikipedia.org/wiki/Heuristic_(computer_science)" title="Heuristic (computer science)">heuristic</a>&nbsp;BLAST&nbsp;family of algorithms, but each tool has tried to deal with the problem of aligning biological sequences in a timely and efficient manner by attempting different algorithmic techniques.</p> <p>If I want to find the zebrafish apex1 gene&#39;s gRNA target site,</p> <p>we need forward primer and reverse primer and target sequence.&nbsp;</p> <p>zebrafish apex1 gene is on the chr 4, and target sequence is &nbsp;GGCTGCCCGGCCGTCCTTAC</p> <p>Forward primers sequence is&nbsp;</p> <table border="0" cellpadding="0" cellspacing="0" style="width:352px"> <tbody> <tr> <td>AAAGAGTTTGCATCCTCACAG</td> </tr> </tbody></table> <p>Reverse primer sequence is&nbsp;</p> <table border="0" cellpadding="0" cellspacing="0" style="width:352px"> <tbody> <tr> <td>CAAGTCCGTTCTTTTTGACC</td> </tr> </tbody></table> <p>Then visit&nbsp;http://genome.ucsc.edu/cgi-bin/hgBlat</p> <p>&nbsp;</p> <p><img alt="" src="/ckfinder/userfiles/images/dd(1).PNG" style="height:768px; width:1366px" /><img alt="" src="/ckfinder/userfiles/images/d.PNG" style="height:768px; width:1366px" /><img alt="" src="/ckfinder/userfiles/images/sd.PNG" style="height:768px; width:1366px" />Like this way, we can find the zebrafish&#39;s apex1 gene gRNA target site and which exon was targeted.&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>Reference</p> <p><br />1. https://en.wikipedia.org/wiki/BLAST</p> <p>2.&nbsp;https://en.wikipedia.org/wiki/BLAT_(bioinformatics)</p> <p>3. http://genome.ucsc.edu/cgi-bin/hgBlat</p> <p>4.&nbsp;&nbsp;<cite>Kent, W James (2002).&nbsp;<a href="http://view.ncbi.nlm.nih.gov/pubmed/11932250" rel="nofollow">&quot;BLAT--the BLAST-like alignment tool&quot;</a>.&nbsp;<em>Genome Research</em>.&nbsp;<strong>12</strong>&nbsp;(4): 656&ndash;664.&nbsp;<a href="https://en.wikipedia.org/wiki/Digital_object_identifier" title="Digital object identifier">doi</a>:<a href="https://dx.doi.org/10.1101%2Fgr.229202" rel="nofollow">10.1101/gr.229202</a>.&nbsp;<a href="https://en.wikipedia.org/wiki/PubMed_Central" title="PubMed Central">PMC</a>&nbsp;<a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC187518" rel="nofollow">187518</a><img alt="Freely accessible" src="https://upload.wikimedia.org/wikipedia/commons/thumb/6/65/Lock-green.svg/9px-Lock-green.svg.png" style="height:14px; width:9px" title="Freely accessible" />.&nbsp;<a href="https://en.wikipedia.org/wiki/PubMed_Identifier" title="PubMed Identifier">PMID</a>&nbsp;<a href="https://www.ncbi.nlm.nih.gov/pubmed/11932250" rel="nofollow">11932250</a>.</cite></p> <p><em>5.&nbsp;</em>Altschul, SF; Gish, W; Miller, W; Myers, EW; Lipman, DJ (1990). &quot;Basic local alignment search tool.&quot;.&nbsp;<em>Journal of Molecular Biology</em>.&nbsp;<strong>215</strong>&nbsp;(3): 403&ndash;10.&nbsp;<a href="https://en.wikipedia.org/wiki/Digital_object_identifier" title="Digital object identifier">doi</a>:<a href="https://dx.doi.org/10.1016%2FS0022-2836%2805%2980360-2" rel="nofollow">10.1016/S0022-2836(05)80360-2</a>.&nbsp;<a href="https://en.wikipedia.org/wiki/PubMed_Identifier" title="PubMed Identifier">PMID</a>&nbsp;<a href="https://www.ncbi.nlm.nih.gov/pubmed/2231712" rel="nofollow">2231712</a>.</p>
Anonymous user

Navigation menu