Changes
Created page with "<p>Before starting coding, we need to think about "Algorithm". </p> <p>"Algorithms are very important in computer Science. The best chosen algorithm makes su..."
<p>Before starting coding, we need to think about "Algorithm". </p>
<p>"Algorithms are very important in computer Science. The best chosen algorithm makes sure computer will do the given task at best possible manner. In cases where efficiency matter a proper algorithm is really vital to be used. An algorithm is important in optimizing a computer program according to the available resources. " (https://www.linkedin.com/pulse/importance-algorithm-its-types-shibaji-debnath)</p>
<p> </p>
<p>Let's start with our homework, Align these 3 DNA sequences</p>
<p>'AAGAATAGTATTTCGCTTTTTTATA';<br />
'AGAAATAGTATTTCGGTTAATTATA';<br />
'AGACATACTAATTCGGTCCATTATA';</p>
<p>Because they have <strong>same length(25b)</strong>, the algorithm is simple,</p>
<p>(1) Start with 5'end base of first sequence. </p>
<p>(2) Compare it with base of second sequence whether they are same or not. </p>
<p>(3) If they are same, remain the base. If they are different, put "-" instead of existing base.</p>
<p>(4) Repeat (2) and (3) wih third sequence.</p>
<p>(5) Repeat (2),(3),(4) with next base until the 3'end base.</p>
<p> </p>
<p>I thought it could be utilized in very restrictive condition, so I wanted to make "Master Code" that could be utilized in any condition.</p>
<p>It is hard to think myself, so I searched on Google. </p>
<p>There was very powerful algorithm. Scoring the alignment and show the best scored alignment results.</p>
<p><u>http://web.skhu.ac.kr/~mckim1/Lecture/DS/dna/class13/class13_04.html (</u>Korean)<br />
<u>Video Lecture : https://www.youtube.com/watch?v=-0gG_rOhcT8</u></p>
<p> </p>
<p>"Algorithms are very important in computer Science. The best chosen algorithm makes sure computer will do the given task at best possible manner. In cases where efficiency matter a proper algorithm is really vital to be used. An algorithm is important in optimizing a computer program according to the available resources. " (https://www.linkedin.com/pulse/importance-algorithm-its-types-shibaji-debnath)</p>
<p> </p>
<p>Let's start with our homework, Align these 3 DNA sequences</p>
<p>'AAGAATAGTATTTCGCTTTTTTATA';<br />
'AGAAATAGTATTTCGGTTAATTATA';<br />
'AGACATACTAATTCGGTCCATTATA';</p>
<p>Because they have <strong>same length(25b)</strong>, the algorithm is simple,</p>
<p>(1) Start with 5'end base of first sequence. </p>
<p>(2) Compare it with base of second sequence whether they are same or not. </p>
<p>(3) If they are same, remain the base. If they are different, put "-" instead of existing base.</p>
<p>(4) Repeat (2) and (3) wih third sequence.</p>
<p>(5) Repeat (2),(3),(4) with next base until the 3'end base.</p>
<p> </p>
<p>I thought it could be utilized in very restrictive condition, so I wanted to make "Master Code" that could be utilized in any condition.</p>
<p>It is hard to think myself, so I searched on Google. </p>
<p>There was very powerful algorithm. Scoring the alignment and show the best scored alignment results.</p>
<p><u>http://web.skhu.ac.kr/~mckim1/Lecture/DS/dna/class13/class13_04.html (</u>Korean)<br />
<u>Video Lecture : https://www.youtube.com/watch?v=-0gG_rOhcT8</u></p>
<p> </p>