Open main menu

Biolecture.org β

Changes

Bioinfromatics HW 1

8,070 bytes added, 03:31, 16 June 2016
Created page with "<p><strong>1. Learn <a href="http://biolecture.org/index.php/Perl" title="Perl">Perl</a> programming language and learn bioinformatics using it.</strong></p> <p>1) <a ..."
<p><strong>1. Learn&nbsp;<a href="http://biolecture.org/index.php/Perl" title="Perl">Perl</a>&nbsp;programming language and learn bioinformatics using it.</strong></p>

<p>1) <a href="http://biolecture.org/index.php/Install_and_Learn_BioPerl" title="Install and Learn BioPerl">Install and Learn BioPerl</a></p>

<p>2) <a href="http://biolecture.org/index.php?title=Pick_5_protein_sequences_and_predict_their_secondary_structures_using_available_prediction_programs&amp;action=edit&amp;redlink=1" title="Pick 5 protein sequences and predict their secondary structures using available prediction programs (page does not exist)">Pick 5 protein sequences and predict their secondary structures using available prediction programs</a></p>

<p>&nbsp;</p>

<p>#!/bin/perl</p>

<p>my $dna = &#39;ATGGCAATGCAGATGCAGCTTGAAGCAAATGCAGATACTTCAGTGGAAGAAGAAAGCTTTGGCCCACAACCCATTTCACGGTTAGAGCAGTGTGGCATAAATGCCAACGATGTGAAGAAATTGGAAGAAGCTGGATTCCATACTGTGGAGGCTGTTGCCTATGCGCCAAAGAAGGAGCTAATAAATATTAAGGGAATTAGTGAAGCCAAAGCTGATAAAATTCTGGCTGAGGCAGCTAAATTAGTTCCAATGGGTTTCACCACTGCAACTGAATTCCACCAAAGGCGGTCAGAGATCATACAGATTACTACTGGCTCCAAAGAGCTTGACAAACTACTTCAAGGTGGAATTGAGACTGGATCTATCACAGAAATGTTTGGAGAATTCCGAACTGGGAAGACCCAGATCTGTCATACGCTAGCTGTCACCTGCCAGCTTCCCATTGACCGGGGTGGAGGTGAAGGAAAGGCCATGTACATTGACACTGAGGGTACCTTTAGGCCAGAACGGCTGCTGGCAGTGGCTGAGAGGTATGGTCTCTCTGGCAGTGATGTCCTGGATAATGTAGCATATGCTCGAGCGTTCAACACAGACCACCAGACCCAGCTCCTTTATCAAGCATCAGCCATGATGGTAGAATCTAGGTATGCACTGCTTATTGTAGACAGTGCCACCGCCCTTTACAGAACAGACTACTCGGGTCGAGGTGAGCTTTCAGCCAGGCAGATGCACTTGGCCAGGTTTCTGCGGATGCTTCTGCGACTCGCTGATGAGTTTGGTGTAGCAGTGGTAATCACTAATCAGGTGGTAGCTCAAGTGGATGGAGCAGCGATGTTTGCTGCTGATCCCAAAAAACCTATTGGAGGAAATATCATCGCCCATGCATCAACAACCAGATTGTATCTGAGGAAAGGAAGAGGGGAAACCAGAATCTGCAAAATCTACGACTCTCCCTGTCTTCCTGAAGCTGAAGCTATGTTCGCCATTAATGCAGATGGAGTGGGAGATGCCAAAGACTGA&#39;;</p>

<p>my $protein = &#39;&#39;;<br />
my $codon;</p>

<p>&nbsp;sub Codon_table {<br />
&nbsp; &nbsp; &nbsp;my($codon) = @_;<br />
&nbsp; &nbsp; &nbsp; &nbsp; if( $codon =~ /TCA/i ){ return &#39;S&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /TCC/i ){ return &#39;S&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /TCG/i ){ return &#39;S&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /TCT/i ){ return &#39;S&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /TTC/i ){ return &#39;F&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /TTT/i ){ return &#39;F&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /TTA/i ){ return &#39;L&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /TTG/i ){ return &#39;L&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /TAC/i ){ return &#39;Y&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /TAT/i ){ return &#39;Y&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /TAA/i ){ return &#39;*&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /TAG/i ){ return &#39;*&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /TGC/i ){ return &#39;C&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /TGT/i ){ return &#39;C&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /TGA/i ){ return &#39;*&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /TGG/i ){ return &#39;W&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /CTA/i ){ return &#39;L&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /CTC/i ){ return &#39;L&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /CTG/i ){ return &#39;L&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /CTT/i ){ return &#39;L&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /CCA/i ){ return &#39;P&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /CCC/i ){ return &#39;P&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /CCG/i ){ return &#39;P&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /CCT/i ){ return &#39;P&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /CAC/i ){ return &#39;H&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /CAT/i ){ return &#39;H&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /CAA/i ){ return &#39;Q&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /CAG/i ){ return &#39;Q&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /CGA/i ){ return &#39;R&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /CGC/i ){ return &#39;R&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /CGG/i ){ return &#39;R&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /CGT/i ){ return &#39;R&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /ATA/i ){ return &#39;I&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /ATC/i ){ return &#39;I&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /ATT/i ){ return &#39;I&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /ATG/i ){ return &#39;M&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /ACA/i ){ return &#39;T&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /ACC/i ){ return &#39;T&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /ACG/i ){ return &#39;T&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /ACT/i ){ return &#39;T&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /AAC/i ){ return &#39;N&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /AAT/i ){ return &#39;N&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /AAA/i ){ return &#39;K&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /AAG/i ){ return &#39;K&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /AGC/i ){ return &#39;S&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /AGT/i ){ return &#39;S&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /AGA/i ){ return &#39;R&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /AGG/i ){ return &#39;R&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /GTA/i ){ return &#39;V&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /GTC/i ){ return &#39;V&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /GTG/i ){ return &#39;V&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /GTT/i ){ return &#39;V&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /GCA/i ){ return &#39;A&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /GCC/i ){ return &#39;A&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /GCG/i ){ return &#39;A&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /GCT/i ){ return &#39;A&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /GAC/i ){ return &#39;D&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /GAT/i ){ return &#39;D&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /GAA/i ){ return &#39;E&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /GAG/i ){ return &#39;E&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /GGA/i ){ return &#39;G&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /GGC/i ){ return &#39;G&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /GGG/i ){ return &#39;G&#39; }<br />
&nbsp; &nbsp; &nbsp;elsif( $codon =~ /GGT/i ){ return &#39;G&#39; }<br />
&nbsp; &nbsp; &nbsp;else{print STDERR &quot;Wrong!!\nPlease check your sequence\n\n&quot;;<br />
&nbsp;&nbsp; &nbsp;&nbsp;&nbsp; &nbsp; &nbsp;exit;}<br />
}</p>

<p>for(my $i=0; $i &lt; (length($dna) - 2)&nbsp;; $i += 3) {<br />
&nbsp; &nbsp; $codon = substr($dna,$i,3);<br />
&nbsp; &nbsp; $protein .= Codon_table($codon);<br />
}</p>

<p>print &quot;\n &nbsp;&lt;DNA&gt;\n\n$dna\n\n &nbsp;&lt;Protein&gt;\n\n$protein\n\n&quot;;</p>

<p>exit;</p>

<p>&nbsp;</p>

<p>&nbsp;</p>

<p style="margin-left:5.9pt"><strong>2. Learn various bioinformatics program and tasks</strong></p>

<p style="margin-left:5.0pt">1) A<a href="http://biolecture.org/index.php?title=Access_http://koreanreference.org/home/index.html_and_search_for_TERT_HUMAN_DNA_region&amp;action=edit&amp;redlink=1" title="Access http://koreanreference.org/home/index.html and search for TERT HUMAN DNA region (page does not exist)">ccess&nbsp;http://koreanreference.org/home/index.html and search for TERT_HUMAN DNA region</a></p>

<p style="margin-left:5.0pt">2) <a href="http://biolecture.org/index.php?title=Install_a_protein_3D_structure_viewer_program_on_your_computer&amp;action=edit&amp;redlink=1" title="Install a protein 3D structure viewer program on your computer (page does not exist)">Install a protein 3D structure viewer program on your computer</a></p>

<p style="margin-left:18.0pt">: I chose Pymol</p>
Retrieved from "https://Biolecture.org/Special:MobileDiff/9691"