Open main menu

Biolecture.org β

Changes

DNA Alignment Algorithm

82 bytes added, 19:07, 23 November 2018
no edit summary
<p>&quot;Algorithms are very important in computer Science. The best chosen algorithm makes sure computer will do the given task at best possible manner. In cases where efficiency matter a proper algorithm is really vital to be used. An algorithm is important in optimizing a computer program according to the available resources. &quot; (https://www.linkedin.com/pulse/importance-algorithm-its-types-shibaji-debnath)</p>
 
<p>&nbsp;</p>
 
<p>It is hard to think the alignment algorithm&nbsp;myself, so I searched on Google.&nbsp;</p>
 
<p>There was a very powerful algorithm. Scoring the alignment and showing the best scored alignment results.</p>
 
<p>This argorithm is called &quot;Needleman-Wunsch algorithm&quot;. If you want to know detail, follow the links below.</p>
 
<p><u>https://en.wikipedia.org/wiki/Needleman%E2%80%93Wunsch_algorithm</u> (Wikipedia)</p>
 
<p><u>http://web.skhu.ac.kr/~mckim1/Lecture/DS/dna/class13/class13_04.html&nbsp;</u><br />
<u>Video Lecture :&nbsp;https://www.youtube.com/watch?v=-0gG_rOhcT8</u></p>
<p>&nbsp;</p>
&#39;AGACATACTAATTCGGTCCATTATA&#39;;</p>
<p>Because they have <strong>same length(25b1)</strong>, the algorithm is simple,Start with 5&#39;end base of sequences.&nbsp;</p>
<p>(12) Start with 5&#39nbsp;end Compare it with base of first one other sequencewhether they are same or not.&nbsp;</p>
<p>(23)&nbsp;Compare it with base of second sequence whether If they are same or not, &quot;Score&quot;+1.&nbsp;If they are different, &quot;Score&quot;-1. Do this work until the 3&#39;end base.</p>
<p>(4) Repeat (2) and (3)&nbsp;If they are same, remain the basewith putting gaps. If they are differentWhenever putting gaps, put &quot;-Score&quot; instead of existing base.-2,</p>
<p>(4)&nbsp;Repeat (2) and (3) wih third sequence.</p> <p>(5) Repeat (2),(3),(4) Find the case with next base until the 3&#39;end basemaximum score. That sequences are best alignment.</p>
<p>&nbsp;</p>
<p>I thought it could be utilized&nbsp;in very&nbsp;restrictive condition, so I wanted to make &quot;Master Code&quot; that could be utilized in any conditionPerl code was available on google (https://www.perlmonks.org/?node_id=819506)</p>
<p>It is hard to think myself, so But it was not work because of some errors. I searched on Googlejust fixed some parts of it.&nbsp;<br />[[Code for alignment]]</p>
<p>There was a very powerful algorithm. Scoring the alignment and showing the best scored alignment results.</p> <p>This argorithm is called &quot;Needleman-Wunsch algorithm&quot;. If you want to know detail, follow the links below.</p> <p><u>https://en.wikipedia.org/wiki/Needleman%E2%80%93Wunsch_algorithm</u> (Wikipedia)</p> <p><u>http://web.skhu.ac.kr/~mckim1/Lecture/DS/dna/class13/class13_04.html&nbsp;</u><br /><u>Video Lecture :&nbsp;https://www.youtube.com/watch?v=-0gG_rOhcT8</u></p>
<p>&nbsp;</p>
Anonymous user