Open main menu

Biolecture.org β

PERL

Revision as of 18:07, 17 June 2016 by imported>Byeongeun Lee

Basic of Perl


1) Variable

Variable is a place to store a value, so we can refer to it or manipulate it throughout program. Perl has three types of variables; scalars, arrays and hases.

Scalar ($) 

Scalar variable stores a single (scalar) value. Perl scalar names are prefixed with a dollar sign ($), so for example, $x, $y, $z, $username, and $url are all examples of scalar variable names. A scalar can hold data of any type, be it a string, a number, or whatnot.

ex) 

$name = "Byeongeun Lee";

Array (@)

An array stores a list of values. While a scalar variable can only store one value, an array can store many. Perl array names are prefixed with an at-sign (@). In Perl, array indices start with 0, so to refer to the first element of the array @colors, you use $colors[0]. Note that when you're referring to a single element of an array, you prefix the name with a $ instead of the @. The $-sign again indicates that it's a single (scalar) value; the @-sign means you're talking about the entire array.

ex)

@Grades = ("A","B","C");

 

Hash (%)

A hash is a special kind of array - an associative array, or paired group of elements. Perl hash names are prefixed with a percent sign (%), and consist of pairs of elements - a key and a data value.

ex)

my %courses = (
    "Cell bio" => "prof.P",
    "Micro" => "prof.M",
);

 

Assignment study


Translate combinations of triple bases into amino acids

 

<strong>$text = "aaatgaccgatcagctacgatcagctataaaaaccccggagctacgatcatcg";</strong>

%convertor = (
    'TCA' => 'S',    # Serine
    'TCC' => 'S',    # Serine
    'TCG' => 'S',    # Serine
    'TCT' => 'S',    # Serine
    'TTC' => 'F',    # Phenylalanine
    'TTT' => 'F',    # Phenylalanine
    'TTA' => 'L',    # Leucine
    'TTG' => 'L',    # Leucine
    'TAC' => 'Y',    # Tyrosine
    'TAT' => 'Y',    # Tyrosine
    'TAA' => '_',    # Stop
    'TAG' => '_',    # Stop
    'TGC' => 'C',    # Cysteine
    'TGT' => 'C',    # Cysteine
    'TGA' => '_',    # Stop
    'TGG' => 'W',    # Tryptophan
    'CTA' => 'L',    # Leucine
    'CTC' => 'L',    # Leucine
    'CTG' => 'L',    # Leucine
    'CTT' => 'L',    # Leucine
    'CCA' => 'P',    # Proline
    'CCC' => 'P',    # Proline
    'CCG' => 'P',    # Proline
    'CCT' => 'P',    # Proline
    'CAC' => 'H',    # Histidine
    'CAT' => 'H',    # Histidine
    'CAA' => 'Q',    # Glutamine
    'CAG' => 'Q',    # Glutamine
    'CGA' => 'R',    # Arginine
    'CGC' => 'R',    # Arginine
    'CGG' => 'R',    # Arginine
    'CGT' => 'R',    # Arginine
    'ATA' => 'I',    # Isoleucine
    'ATC' => 'I',    # Isoleucine
    'ATT' => 'I',    # Isoleucine
    'ATG' => 'M',    # Methionine
    'ACA' => 'T',    # Threonine
    'ACC' => 'T',    # Threonine
    'ACG' => 'T',    # Threonine
    'ACT' => 'T',    # Threonine
    'AAC' => 'N',    # Asparagine
    'AAT' => 'N',    # Asparagine
    'AAA' => 'K',    # Lysine
    'AAG' => 'K',    # Lysine
    'AGC' => 'S',    # Serine
    'AGT' => 'S',    # Serine
    'AGA' => 'R',    # Arginine
    'AGG' => 'R',    # Arginine
    'GTA' => 'V',    # Valine
    'GTC' => 'V',    # Valine
    'GTG' => 'V',    # Valine
    'GTT' => 'V',    # Valine
    'GCA' => 'A',    # Alanine
    'GCC' => 'A',    # Alanine
    'GCG' => 'A',    # Alanine
    'GCT' => 'A',    # Alanine
    'GAC' => 'D',    # Aspartic Acid
    'GAT' => 'D',    # Aspartic Acid
    'GAA' => 'E',    # Glutamic Acid
    'GAG' => 'E',    # Glutamic Acid
    'GGA' => 'G',    # Glycine
    'GGC' => 'G',    # Glycine
    'GGG' => 'G',    # Glycine
    'GGT' => 'G',    # Glycine
    );


for ($s=0; $s<3; $s++) {
        $scrap = substr($text,0,$s);
        $main = substr($text,$s);
        $main =~ s/(...)/"$convertor{uc $1}" || "?"/eg;
        print "$scrap$main\n";
        }

 

%convertor = ( ~~~ );

= used for giving information for translation (codon into amino acids)

for ($s=0; $s<3; $s++)