Difference between revisions of "Scientific Experiment"

From Biolecture.org
imported>조우빈
imported>조우빈
 
(10 intermediate revisions by the same user not shown)
Line 277: Line 277:
 
<div><u><strong>&nbsp;-&gt; Omics could be applied to genomics perspective!</strong></u></div>
 
<div><u><strong>&nbsp;-&gt; Omics could be applied to genomics perspective!</strong></u></div>
  
−
<p>&nbsp;</p>
+
<p>[[File:Self1.png|400px]]</p>
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
Line 368: Line 368:
  
 
<p>&nbsp;[[File:14.png|400px]]</p>
 
<p>&nbsp;[[File:14.png|400px]]</p>
 +
 +
<p>-&gt; Can see the insert(300bp) in both 54,56,58 temperature gradient!</p>
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
 +
 +
<p>&nbsp;(2)</p>
 +
 +
<p>&lt;T vector ligation&gt;</p>
 +
 +
<p>Insert DNA mass: 8.607ng(3:1)</p>
 +
 +
<p>2X Rapid ligation: 5ul</p>
 +
 +
<p>T vector: 0.5ul(25ng)</p>
 +
 +
<p>PCR product: 1ul(8.7ng)</p>
 +
 +
<p>D.W: 2.5ul</p>
 +
 +
<p>T4 DNA Ligase: 1ul</p>
 +
 +
<p>----------------------------</p>
 +
 +
<p>Total: 10ul</p>
 +
 +
<p>RT 1 hour incubation</p>
 +
 +
<p>Then, Transformation</p>
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
 +
 +
<p>&lt;Colony PCR&gt;</p>
 +
 +
<p>-&gt; Check whether insert base pairs is inserted in T vector well</p>
 +
 +
<p>T.D.W : 14.9</p>
 +
 +
<p>10X Buffer : 2</p>
 +
 +
<p>M13 primer Forward: 0.5</p>
 +
 +
<p>M13 primer Reverse: 0.5</p>
 +
 +
<p>2.5mM dNTP: 1.6</p>
 +
 +
<p>XL-Taq polymerase: 0.5</p>
 +
 +
<p>&nbsp;---------------------------------</p>
 +
 +
<p>[[File:15.jpg|400px]]</p>
 +
 +
<p>Can check on 3,5 well(T vector 200bp+ 346bp = 500~600bp)</p>
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
 +
 +
<p>&nbsp;(3)</p>
 +
 +
<p>EcoR1 pRL mETP SpyTag Stop Xho1(3,5), pRA_GFP Digestion(EcoR1,Xho1)</p>
 +
 +
<p>&nbsp;[[File:17.png|400px]]</p>
 +
 +
<p>pRA_GFP Digestion(EcoR1,Xho1) EcoR1 pRL mETP SpyTag Stop Xho1(3,5) Extraction</p>
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
 +
 +
<p>&nbsp;(4)</p>
 +
 +
<p>EcoR1 pRL mETP SpyTag Stop Xho1 Tvector&amp;pRA_GFP_mETP&amp;pRA_GFP Digestion(EcoR1,Xho1)</p>
 +
 +
<p>[[File:18.png|400px]]</p>
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
 +
 +
<p>(5)</p>
 +
 +
<p>&lt;Ligation&gt;</p>
 +
 +
<p>EcoR1_pRL_mETP_SpyTag_Stop_Xho1 T-Vector</p>
 +
 +
<p>-&gt; insert(9.3ng/ul): 1.5ul</p>
 +
 +
<p>-&gt; vector(19.3ng/ul): 3ul</p>
 +
 +
<p>-&gt; T4 DNA ligase Buffer: 1ul</p>
 +
 +
<p>-&gt; T4 DNA Enzyme: 1ul</p>
 +
 +
<p>-&gt; D.W: 3.5</p>
 +
 +
<p>Transformation</p>
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
 +
 +
<p>pRA_GFP EcoR1 pRL mETP SpyTag Stop Xho1 Double Digestion(EcoR1,Xho1)</p>
 +
 +
<p>[[File:19.png|400px]]</p>
 +
 +
<p>------------------------------------------------------------------------------------------</p>
 +
 +
<p>Midi-prep &amp;Transfection</p>
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
 +
 +
<div>1.Opti-MEM+ DNA(each: 3ug)= 250ul</div>
 +
 +
<div>2.(Opti-MEM 241ul+TR 9ul)*2 master mix (vortex well)</div>
 +
 +
<div>3.Put 2 into 1 250ul per each &amp; mix(1min) , stand 30min</div>
 +
 +
<div>4.Treat #3 to H-293 Cell, media change after 10hours</div>
 +
 +
<div>5.Change media to serum free (starvation) Media change after 1day (Check GFP signal)</div>
 +
 +
<div>6.Prepare lysate after 2days(between 24~48hours) (check whether plasmid is well overexpressed by western blot)</div>
 +
 +
<div>7.Put Media 520ul per each in e.tube and 4 celcius 13000rpm, 1min centrifuge, get 500ul of each centrifuged into column and do 45min 13000rpm, 4celcius centrifuge</div>
 +
 +
<p>(Media = conditioned media(CM))</p>
 +
 +
<p>* Store rest of media는 in other tube (labeling)</p>
 +
 +
<p>8. Wash rest of cell in 1X PBS(cold) and after wash, do suction</p>
 +
 +
<p>9. Treat Lysis buffer 200ul and scrape using stripper. Collect all of them in E.tube &amp; labeling, incubation 10 min in cold ice, then 15min 13000rpm, 4celcius centrifuge</p>
 +
 +
<p>(After sup media of centrifuged = cell extract(TCE))</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>Transfection</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<div>1.Opti-MEM+ DNA(each: 3ug)= 250ul</div>
 +
 +
<div>2.(Opti-MEM 241ul+TR 9ul)*2 master mix (vortex well)</div>
 +
 +
<div>3.Put 2 into 1 250ul per each &amp; mix(1min) , stand 30min</div>
 +
 +
<div>4.Treat #3 to H-293 Cell, media change after 10hours</div>
 +
 +
<div>5.Change media to serum free (starvation) Media change after 1day (Check GFP signal)</div>
 +
 +
<div>6.Prepare lysate after 2days(between 24~48hours) (check whether plasmid is well overexpressed by western blot)</div>
 +
 +
<div>7.Put Media 520ul per each in e.tube and 4 celcius 13000rpm, 1min centrifuge, get 500ul of each centrifuged into column and do 45min 13000rpm, 4celcius centrifuge</div>
 +
 +
<p>(Media = conditioned media(CM))</p>
 +
 +
<p>* Store rest of media는 in other tube (labeling)</p>
 +
 +
<p>8. Wash rest of cell in 1X PBS(cold) and after wash, do suction</p>
 +
 +
<p>9. Treat Lysis buffer 200ul and scrape using stripper. Collect all of them in E.tube &amp; labeling, incubation 10 min in cold ice, then 15min 13000rpm, 4celcius centrifuge</p>
 +
 +
<p>(After sup media of centrifuged = cell extract(TCE))</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p><span style="font-size:14px">Western Blot</span></p>
 +
 +
<p>[[File:Ex1.png|400px]]</p>
 +
 +
<p>tx621(anti-mETP) - (mETP-spytag CM, TCE)</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>pRA-mETP-SpyTag Size Exclusion &nbsp;</p>
 +
 +
<p>[[File:Ex2.jpg|400px]]</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>(2)pTrc-Spe1-SpyCatcher-Xho1-APEX2</p>
 +
 +
<p>(E.Coli expression vector)</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>(3) pTrc-Spe1-mETP-Xho1-APEX2</p>
 +
 +
<p>(E.Coli expression vector)</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>(2) pTrc-Spe1-SpyCatcher-Xho1-APEX2 (E.Coli expression vector)</p>
 +
 +
<p>- APEX2 Sequence(318bp, 26.38kda)</p>
 +
 +
<p>Cgaaagtcttacccaactgtgagtgctgattaccaggacgccgttgagaaggcgaagaagaagctcagaggcttcatcgctgagaagagatgcgctcctctaatgctccgtttggcattccactctgctggaacctttgacaagggcacgaagaccggtggacccttcggaaccatcaagcaccctgccgaactggctcacagcgctaacaacggtcttgacatcgctgttaggcttttggagccactcaaggcggagttccctattttgagctacgccgatttctaccagttggctggcgttgttgccgttgaggtc</p>
 +
 +
<p>- SpyCatcher(385bp, 31.36kda)</p>
 +
 +
<p>ATGGTTGATACCTTATCAGGTTTATCAAGTGAGCA</p>
 +
 +
<p>AGGTCAGTCCGGTGATATGACAATTGAAGAAGATAGTGCTACCCATATTAAATTCTCAAAACGTGATGAG</p>
 +
 +
<p>GACGGCAAAGAGTTAGCTGGTGCAACTATGGAGTTGCGTGATTCATCTGGTAAAACTATTAGTACATGGA</p>
 +
 +
<p>TTTCAGATGGACAAGTGAAAGATTTCTACCTGTATCCAGGAAAATATACATTTGTCGAAACCGCAGCACC</p>
 +
 +
<p>AGACGGTTATGAGGTAGCAACTGCTATTACCTTTACAGTTAATGAGCAAGGTCAGGTTACTGTAAATGGC</p>
 +
 +
<p>AAAGCAACTAAAGGTGACGCTCATATTTAAATGGTTGATGCTTGAGGATCCGAATTCGAGCTCCGTCGAC</p>
 +
 +
<p>[[File:Ex3.jpg|400px]]</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>(2) pTrc-Spe1-SpyCatcher-Xho1-APEX2 (E.Coli expression vector) sequencing data</p>
 +
 +
<p>[[File:Ex4.png|400px]]</p>
 +
 +
<p>*pTRC sequencing primer</p>
 +
 +
<p>F: 5&rsquo;-AGCTGTTGACAATTAATCATCCGGC-3&rsquo;</p>
 +
 +
<p>R: 5&#39;-TCTGCGTTCTGATTTAATCTGTATCAGGC-3&lsquo;</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>(2)pTRC_APEX2_SpyCatcherSpe1Xho1(Spe1-SpyCatcher-Xho1)</p>
 +
 +
<p>[[File:Ex5.png|400px]]</p>
 +
 +
<p>(3) pTrc-Spe1-mETP-Xho1-APEX2(39.1kda) expected sequence</p>
 +
 +
<p>[[File:Ex6.png|400px]]</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>(3) pTrc-Spe1-mETP-Xho1-APEX2 (E.Coli expression vector)</p>
 +
 +
<p>1.Add Spe1, Xho1 between mETP</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>PCR(Ex-Nrg1)</p>
 +
 +
<p>-TDW :37.75ul</p>
 +
 +
<p>-10X EX Taq Buffer : 5ul</p>
 +
 +
<p>-Primer(R/F): &nbsp;1ul(per each)</p>
 +
 +
<p>-Template(mETP): 1ul(10ng) -----------X4(temperature gradient: 54,56,58,60)</p>
 +
 +
<p>-2.5mM dNTP MIX: 4ul</p>
 +
 +
<p>-Ex Taq Polymerase: 0.25ul</p>
 +
 +
<p>------------------------------</p>
 +
 +
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 50ul</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>Purify</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>-Use mini-prep kit</p>
 +
 +
<p>&nbsp;(PW buffer 650ul, product 50ul in column, 30sec centrifuge, discard bottom one and 1min centrifuge, transfer column to1.5ml tube, 2nd D.W 35ml , stand 1min, 1min centrifuge</p>
 +
 +
<p>-&gt;purified mETP Ex-Tag PCR product(56,58,60)</p>
 +
 +
<p>[[File:Ex7.jpg|400px]]</p>
 +
 +
<p>mETP(Spe1-mETP-Xho1) ExTaq gradient PCR(54,.56,58,60)</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>&lt;T vector Cloning&gt;</p>
 +
 +
<p>-&gt; mETP Ex-Taq PCR (each end A exists) ligate into T vector(=pGEM-T easy vector, each end T exists), Transformation to E.coli</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>-Ligation</p>
 +
 +
<p>-</p>
 +
 +
<p>-&gt;NEB Calculator site(nebiocalculator.net.com/#!/ligation) insert length(mETP =204, primer, total 222bp), vector length(T vector :3015bp), T vector mass</p>
 +
 +
<p>-&gt;3:1=&gt; insert 5.522ng</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>-&gt; 2X Rapid Ligation buffer: 5ul</p>
 +
 +
<p>&nbsp;&nbsp;&nbsp; T vector: 0.5ul</p>
 +
 +
<p>&nbsp;&nbsp;&nbsp; PCR product(Insert):</p>
 +
 +
<p>&nbsp;&nbsp;&nbsp; D.W :</p>
 +
 +
<p>T4 DNA Ligase: 1ul</p>
 +
 +
<p>---------------------------------------</p>
 +
 +
<p>&nbsp;&nbsp; Total: 10ul</p>
 +
 +
<p>1hour RT incubation</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>[[File:Ex8.jpg|400px]]</p>
 +
 +
<p>&lt;Colony PCR&gt;</p>
 +
 +
<p>T.D.W : 14.9</p>
 +
 +
<p>10X Buffer : 2</p>
 +
 +
<p>M13 primer Forward: 0.5</p>
 +
 +
<p>M13 primer Reverse: 0.5</p>
 +
 +
<p>2.5mM dNTP: 1.6</p>
 +
 +
<p>XL-Taq polymerase: 0.5</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>Phusion Colony PCR</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>Replica 4,7</p>
 +
 +
<p>Double Digestion</p>
 +
 +
<p>(1) pTrc Vector(pTrc-Spycatcher-APEX2,3410ng/ul): 5ug(1.5ul)</p>
 +
 +
<p>Enzyme(Spe1, Xho1): each 1.5ul</p>
 +
 +
<p>Buffer(Cutsmart,10X):1ul</p>
 +
 +
<p>T.D.W:4.5ul</p>
 +
 +
<p>------------------------------------------------------</p>
 +
 +
<p>10ul</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>(2) pTrc Vector( expected to be Spycatcher Cut ,15ng/ul): 15ul(225ng)</p>
 +
 +
<p>Enzyme(Spe1, Xho1):&nbsp; 1ul(each)</p>
 +
 +
<p>Buffer(Cutsmart,10X): 2ul</p>
 +
 +
<p>T.D.W:1</p>
 +
 +
<p>------------------------------------------------------</p>
 +
 +
<p>20ul</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>(3) mETP T-vector</p>
 +
 +
<p>-&gt; Restriction Enzyme(Spe1, Xho1): 1.5ul 씩</p>
 +
 +
<p>-&gt; Tvector(735ng/ul): 6.8ul(5ng)</p>
 +
 +
<p>-&gt; 10X Buffer: 2ul</p>
 +
 +
<p>-&gt; T.D.W: 8.2ul</p>
 +
 +
<p>--------------------------------------------------</p>
 +
 +
<p>&nbsp;20ul</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>37 celcius incubation</p>
 +
 +
<p>[[File:Ex9.png|400px]]</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>Ligation</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>-&gt; Insert: 212bp</p>
 +
 +
<p>-&gt; Vector DNA mass: 50ng</p>
 +
 +
<p>-&gt; 3:1</p>
 +
 +
<p>=&gt; Insert DNA mass: 7.227ng</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>10X T4 DNA Ligase buffer: 3ul</p>
 +
 +
<p>Vector DNA: 50ng(17ul)</p>
 +
 +
<p>Insert DNA: 7.227ng(2.06ul)</p>
 +
 +
<p>D.W: 6.94ul</p>
 +
 +
<p>T4 DNA Ligase: 1ul</p>
 +
 +
<p>---------------------------------------------------------------</p>
 +
 +
<p>Total: 30ul</p>
 +
 +
<p>RT incubation</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>-&gt;Transformation</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>-&gt; Colony: 4</p>
 +
 +
<p>-&gt; incubation</p>
 +
 +
<p>-&gt;Mini-prep</p>
 +
 +
<p>-&gt; 1.5% gel, 4 Digestion</p>
 +
 +
<p>[[File:Ex10.png|400px]]</p>
 +
 +
<p>pTrc Spe1-mETP-Xho1 colony(1,2,3,4)</p>
 +
 +
<p>Double Digestion</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>(3) pTrc-Spe1-mETP-Xho1-APEX2 (E.Coli expression vector) sequencing result</p>
 +
 +
<p>[[File:Ex11.png|400px]]</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>(2) pTrc-Spe1-SpyCatcher-Xho1-APEX2 (E.Coli expression vector)</p>
 +
 +
<p>(3) pTrc-Spe1-mETP-Xho1-APEX2 (E.Coli expression vector) sequencing result</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>(1)Protein expression by transformation on Ecoli(BL21)</p>
 +
 +
<p>*Store each of E.coli in -80 celcius Deep Freezer</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>(2)Do IPTG induction test(small scale) to check whether it is soluble, overexpress or not</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>(3) Get protein &amp; purify!</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>&lt;Protein induction &amp; soluble test protocol&gt;</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>1.Incubate E.coli with 5ml+antibiotic LB&nbsp; (previous day)</p>
 +
 +
<p>●</p>
 +
 +
<p>2.Dilute up to 1:50(2%) and incubate with new bottle</p>
 +
 +
<p>●</p>
 +
 +
<p>3.Incuabte until OD(optical density) reach 0.5~0.8 &nbsp;at 600nm. Then, divide it into 1.5ml tube 200ul tube(IPTG(-), store at 4 celcius)</p>
 +
 +
<p>●</p>
 +
 +
<p>4.Treat IPTG(=molecular biology reagent) &nbsp;(final: 0.5mM/L , 1M*xL = 0.5mM*yL)</p>
 +
 +
<p>Ex:&nbsp;&nbsp;&nbsp; For 200ml, 100ul 1M IPTG is needed</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>5. Incubate ITPG treated with 37 celcius shaker about 3.5 hours</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>6. Divide it into 1.5ml tube 200ul (14000rpm,1min centrifuge, label IPTG(+) Sup &nbsp;to Sup(supernatant, Wash the ppt(pallet) with T.D.W 50ul and label it to IPTG(+) PPT and store both with 4 celcius )</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>7. Centrifuge rest of them (4000rpm, 15min) &amp; remove sup</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>8. Resuspension it with Phosphate buffer(=Ni-NTA wash buffer, (20mM Tris HCl(pH 8), 150mM NaCl, 20mM Imidazole))</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>9. &nbsp;centrifuge, remove sup</p>
 +
 +
<p>10. Resuspension each with (1L: 30~35ml wash buffer )</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>11. Treat Lysozyme(50ul per 1L) and incubate it with shaking (0.5~1h RT)</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>12. sonication(20 amplitude, 10min(processing time : 5min)</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>13. Take 50ul and divide it into ppt&amp;SUP to check solubility</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>14. Centrifuge Rest of them except 50ul with 10000rpm, isolate Sup and ppt. Label each of them with IPTG(+) sonication(+) sup, ppt, IPTG(+) sonication(-) sup, ppt</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>15. Mix Labeled with 5X SDS buffer and boil it with 100 celcius(5~10min)</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>* Store it in -20 celcius</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>pTrc-Spe1-mETP-Xho1-APEX2 protein size</p>
 +
 +
<p>Open reading frame(ORF): 1068bp, 355 amino acids, 39.1kDa</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>&THORN;10% gel commassie blue(60v-&gt;120v)</p>
 +
 +
<p>[[File:Ex12.png|400px]]</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>(3) pTrc-Spe1-mETP-Xho1-APEX2 protein his column purification</p>
 +
 +
<p>(E.Coli expression vector)</p>
 +
 +
<p>[[File:Ex13.jpg|400px]]</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>His column purification Comassie blue staining</p>
 +
 +
<p>[[File:Ex14.png|400px]]</p>
 +
 +
<p>(3) pTrc-Spe1-mETP-Xho1-APEX2 protein</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>#19 size exclusion(purification)</p>
 +
 +
<p>[[File:Ex15.jpg|400px]]</p>
 +
 +
<p>(3) pTrc-Spe1-mETP-Xho1-APEX2 protein</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>(1)pRA-GFP-pRL-mETP-SpyTag-Stop-Xho1 (mammalian expression vector)</p>
 +
 +
<p>&amp;&nbsp;(2) pTrc-Spe1-SpyCatcher-Xho1-APEX2</p>
 +
 +
<p>(E.Coli expression vector)&nbsp;</p>
 +
 +
<p>Binding test</p>
 +
 +
<p>(protein to protein)</p>
 +
 +
<p>[[File:Ex16.png|400px]]&nbsp;[[File:Ex17.jpg|400px]]&nbsp;</p>
 +
 +
<p>* pRA-mETP-SpyTag_CM 10ul(concentrated)</p>
 +
 +
<p>pTrc-Spycatcher 200ng, 500ng, 100ng, 200ng, 500ng, 1000ng</p>
 +
 +
<p>&nbsp;binding test(Anti His) (15%)</p>
 +
 +
<p>* pRA-mETP-SpyTag_CM 10ul(concentrated)</p>
 +
 +
<p>pTrc-Spycatcher 200ng, 500ng, 100ng, 200ng, 500ng, 1000ng</p>
 +
 +
<p>binding test(Anti mETP(Tx621))(15%)</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>Further study &amp; Prospect</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>-Do protein interaction experiment in cell to see whether it is well connected in vitro</p>
 +
 +
<p>-</p>
 +
 +
<p>-</p>
 +
 +
<p>-Find the protein that is correlated with mETP through &lsquo;mass spectroscopy&rsquo; technique</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>&nbsp;&nbsp;&nbsp; -&gt; Therefore, we can identify unknown &lsquo;protein&rsquo; and its gene and their location.</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>-Applied to Genomics</p>
 +
 +
<p>&nbsp;&nbsp;&nbsp;</p>
 +
 +
<p>&nbsp;&nbsp;-&gt; Analyze how different, how overexpressed, how different of unknown &lsquo;protein&rsquo; gene between obese people to lean people by genome sequencing of certain region of unknown &lsquo;protein&rsquo; gene</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>Reference</p>
 +
 +
<p>&nbsp;</p>
 +
 +
<p>-&nbsp;&nbsp; Definition of Proteomics <a href="http://biolecture.org/index.php/Proteomics">http://</a><a href="http://biolecture.org/index.php/Proteomics">biolecture.org/index.php/Proteomics</a></p>
 +
 +
<p>-&nbsp;&nbsp; Definition of Omics <a href="http://biolecture.org/index.php/Omics">http</a><a href="http://biolecture.org/index.php/Omics">://</a><a href="http://biolecture.org/index.php/Omics">biolecture.org/index.php/Omics</a></p>
 +
 +
<p>-Bhak, J. (2016, 6 13). Openfree biolecture. Retrieved from Openfree biolecture: <u><a href="http://biolecture.org/index.php/SELF:_Self_evaluating_learning_framework">http://biolecture.org/index.php/SELF:_Self_evaluating_learning_framework</a></u></p>
 +
 +
<p>-Endotrophin triggers adipose tissue fibrosis and metabolic dysfunction. <u><a href="https://www.ncbi.nlm.nih.gov/pubmed/24647224">https://www.ncbi.nlm.nih.gov/pubmed/24647224</a></u></p>
 +
 +
<p>-Adipocyte-derived endotrophin promotes malignant tumor progression</p>
 +
 +
<p><u><a href="https://www.jci.org/articles/view/63930">https://www.jci.org/articles/view/63930</a></u></p>
 +
 +
<p>-Secrets of a covalent interaction for biomaterials and biotechnology: SpyTag and SpyCatcher.</p>
 +
 +
<p><u><a href="https://www.ncbi.nlm.nih.gov/pubmed/26517567">https://www.ncbi.nlm.nih.gov/pubmed/26517567</a></u></p>
 +
 +
<p>-Directed evolution of APEX2 for electron microscopy and proximity labeling.</p>
 +
 +
<p><u><a href="https://www.ncbi.nlm.nih.gov/pubmed/25419960">https://www.ncbi.nlm.nih.gov/pubmed/25419960</a></u></p>
 +
 +
<p>-From genomics to proteomics (Nature Review)</p>
 +
 +
<p><u><a href="http://www.nature.com/nature/journal/v422/n6928/full/nature01510.html">http://www.nature.com/nature/journal/v422/n6928/full/nature01510.html</a></u></p>
 +
 +
<p>-Innovation: Metabolomics: the apogee of the omics trilogy</p>
 +
 +
<p><u><a href="http://www.nature.com/nrm/journal/v13/n4/abs/nrm3314.html">http://www.nature.com/nrm/journal/v13/n4/abs/nrm3314.html</a></u></p>
 +
 +
<p>-Mass-spectrometric exploration of proteome structure and function</p>
 +
 +
<p><u><a href="http://www.nature.com/nature/journal/v537/n7620/abs/nature19949.html">http://www.nature.com/nature/journal/v537/n7620/abs/nature19949.html</a></u></p>
  
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>

Latest revision as of 15:11, 6 December 2016

 

Obese in Genomics

 

What is Obese?

-Obesity is a medical condition in which excess body fat has accumulated to the extent that it may have a negative effect on health.
 
-People are generally considered obese when their body mass index (BMI), a measurement obtained by dividing a person's weight by the square of the person's height, is over 30 kg/m2 , with the range 25–30 kg/m2 defined as overweight
 
-Obesity increases the likelihood of various diseases, particularly heart disease, type 2 diabetes, obstructive sleep apnea, certain types of cancer, and osteoarthritis.
 
-Obesity is most commonly caused by a combination of excessive food intake, lack of physical activity, and genetic susceptibility.
 

 

Arrangement of basic terms in Genomics

 

What is Genomics?

Genomics is the omics study of genes of individual organisms, populations, and species.

Paradigm of performing biological science that deviates from investigating single genes, their functions, and roles.

 

What is Omics?

General term for a broad discipline of science and engineering

Analyzing the interactions of biological information objects in various omes in biology

Main focus

1)mapping information objects such as genes and proteins
2)finding interaction relationships among the objects
3)engineering the networks and objects to understand and manipulate the regulatory mechanisms
 
 
What is Proteomics?
 

Omics study of proteins, particularly their structures, sequences, and functions.

   (which proteins interact)

 

The set of proteins produced by it during its life, and its genome is its set of genes.

 

A proteome differs from cell to cell and constantly changes through its biochemical interactions with the genome and the environment.

=> One organism has radically different protein expression in different parts of its body, different stages of its life cycle and different environmental conditions

*There are far fewer protein-coding genes in the human genome than proteins in the human proteome (20,000 to 25,000 genes vs. > 500,000 proteins)

=> Protein diversity is thought to be due to alternative splicing and post-translational modification of proteins

 

New methods include protein microarrays, immunoaffinity chromatography followed by mass spectrometry(MALDI-TOF mass spectrometry), and combinations of experimental methods such as phage display and computational methods.

 

What is Metabolome?

 

Interaction between an organism’s genome and its environment

 

Complete set of small-molecule chemicals found within a biological sample.

 

The small molecule chemicals found in a given metabolome may include both endogenous metabolites that are naturally produced by an organism as well as exogenous chemicals

 

The endogenous metabolome

-> primary metabolome

-> Secondary metabolome

 

* primary metabolite is directly involved in the normal growth, development, and reproduction.

*secondary metabolite is not directly involved in those processes, but usually has important ecological function(ex: pigments, antibiotics or waste products derived from partially metabolized xenobiotics)

Use NMR spectroscopy and mass spectrometry.

 

 

The Human Metabolome Database

 

Contain detailed data on more than 40,000 metabolites that have already been identified or are likely to be found in the human body

 

1)Chemical information

- includes >40,000 metabolite structures with detailed descriptions, extensive chemical classifications, synthesis information and observed/calculated chemical properties

 
2)Clinical information

- includes data on >10,000 metabolite-biofluid concentrations, metabolite concentration information on more than 600 different human diseases and pathway data for more than 200 different inborn errors of metabolism.

 
 
3)Biochemical information.

- includes nearly 6000 protein (and DNA) sequences and more than 5000 biochemical reactions that are linked to these metabolite entries

 

---------------------------------------------

Obese

 

-> Mainly Influenced by External effects!

-> The Disease that can be cured!

-> Obese parents usually have obese children!

 

Therefore, Focus more on protemoics, Metabolome!

 -----------------------------------------------------------------------

Adipose tissue

 

-> Adipokine

   -> Adipose tissue secreted multiple mediator

   -> Passed through either endocrine or paracrine

       Ex: Hormone: leptin, adiponectin

 

-> Adiponectin

    -> Adipocyte-secreted adipokine

    -> Increase lipid oxidation& anti-inflammatory, insulin-sensitizing,  angiogenic action

    => Anti obesity & Antidiabetic, Decrease insulin resistance 

 400px

 

 

 400px

-> Illustration of the major physiological and metabolic

processes with which adipose tissue is involved through the secretion

of various adipokines from adipocytes. The interactions may be

autocrine, paracrine, or endocrine.

 

<Searching Scientific Reports>

 400px

 400px

 

<What is Col6?>

- COL6 = Collagen type 6

- Abundant constituent of white adipose tissue (WAT)

- COL6 levels positively correlate with hyperglycaemia and insulin resistance

- Composed of three distinct a chains, a1, a2 and a3.(COL6 trimeric building block) and are subsequently secreted into the ECM

 

<What is a3 Chain?>

-> longest of the three chains

- contains an unusually long N terminus and a globular C5 domain at the C-terminus

 

-> C-terminal portion of the a3 subunit is cleaved off during the post-translational processing of COL6 fibrils(COL6a3, Endotrophin)

 

<What is Endotrophin?>

- Adipokine with potent tumour-promoting effects

- Plays a pivotal role in shaping a metabolically unfavorable microenvironment in adipose tissue during consumption of a high-fat diet (HFD)

- Powerful co-stimulator of pathologically relevant pathways within the ‘unhealthy’ adipose tissue milieu, triggering fibrosis and inflammation and ultimately leading to enhanced insulin resistance& metabolic dysfunction.

- Exerts a major influence in adipose tissue

- Endotrophin within the tumor microenvironment serves as a major mediator of COL6-stimulated mammary tumor growth and subsequent chemo resistance

- Stimulates fibrosis, activates endothelial cell migration and promotes macrophage infiltration into growing solid tumors.

=> elevated mammary tumor expansion and more pronounced metastatic growth

 400px

---------------------------------------------------------

Problem!

 

-> Don’t know the mechanism of how ETP works.

 

What I’m going to do!

 

-> Find the Receptor according to the New method of Protemoics.
-> Find the interaction, relationship and mechanisms how they act.(Study of Omics)
 -> Omics could be applied to genomics perspective!

400px

 

mETP(204bp, 16.43kda)

ACAGAACCATTGTTTCTCACTAAAACAGATATATGTAAGCTGTCCAGAGATGCTGGGACTT

GTGTGGACTTCAAGTTACTATGGCACTATGACCTAGAGAGCAAAAGTTGCAAGAGATTCTG

GTATGGAGGTTGTGGAGGCAACGAGAACAGATTCCACTCCCAGGAAGAATGTGAAAAGATGTGTAGTCCTGAGTTAACAGTT

 

SpyTag(39bp, 16.43kda)

GCCCACATCGTGATGGTGGACGCCTACAAGCCGACGAAG

 

pRL(90bp, 7.48kda)

ATGGACAGCAAAGGTTCGTCGCAGAAAGGGTCCCGCCTGCTCCTGCTGCTGGTGGTGTCAAATCTACTCTTGTGCCAGGGTGTGGTCTCC

 

(1)

 600px

 pRA-GFP-EcoR1-pRL-unknown-mETP-SpyTag-Stop

 

-> How to make this cloning?

(1)By Using pRL-EcoR1 forward primer, mETP-SpyTag-Stop-Xho1 primer, make pRL-EcoR1-mETP-SpyTag-Stop-Xho1 by Ex-Tag PCR

500px

(2) Insert template gained from (1) in T-Vector to check whether it is really pRL-EcoR1-mETP-SpyTag-Stop-Xho1 or not.

(3) Use EcoR1, Xho1 Digestion enzyme to double digest T vector

(4) Double Digest pRA GFP vector(empty vector) and purify it.

(5) ligate (3), (4) product

 

-> Detailed on Each Steps

(1) Ex-Tag PCR process

 

->Template(pRA-GFP, 20ng): 1ul

->Primer: 1,1ul

->dNTP(10nM): 1ul

->10X Ex-Tag Buffer: 2.5ul

-> Ex-Tag polymerase: 1ul

-> D.W: 17.5ul

----------------------------------------

Total: 25ul

 

PCR

->Temperature Gradient : 54,56,58

->98 celsius : 2min

->98 celsius : 10sec

->57 celsius : 30sec

->72 celsius : 30sec(insert 300bp)

->72 celsius : 5min

X35

 400px

-> Can see the insert(300bp) in both 54,56,58 temperature gradient!

 

 (2)

<T vector ligation>

Insert DNA mass: 8.607ng(3:1)

2X Rapid ligation: 5ul

T vector: 0.5ul(25ng)

PCR product: 1ul(8.7ng)

D.W: 2.5ul

T4 DNA Ligase: 1ul

----------------------------

Total: 10ul

RT 1 hour incubation

Then, Transformation

 

<Colony PCR>

-> Check whether insert base pairs is inserted in T vector well

T.D.W : 14.9

10X Buffer : 2

M13 primer Forward: 0.5

M13 primer Reverse: 0.5

2.5mM dNTP: 1.6

XL-Taq polymerase: 0.5

 ---------------------------------

15.jpg

Can check on 3,5 well(T vector 200bp+ 346bp = 500~600bp)

 

 (3)

EcoR1 pRL mETP SpyTag Stop Xho1(3,5), pRA_GFP Digestion(EcoR1,Xho1)

 400px

pRA_GFP Digestion(EcoR1,Xho1) EcoR1 pRL mETP SpyTag Stop Xho1(3,5) Extraction

 

 (4)

EcoR1 pRL mETP SpyTag Stop Xho1 Tvector&pRA_GFP_mETP&pRA_GFP Digestion(EcoR1,Xho1)

400px

 

(5)

<Ligation>

EcoR1_pRL_mETP_SpyTag_Stop_Xho1 T-Vector

-> insert(9.3ng/ul): 1.5ul

-> vector(19.3ng/ul): 3ul

-> T4 DNA ligase Buffer: 1ul

-> T4 DNA Enzyme: 1ul

-> D.W: 3.5

Transformation

 

pRA_GFP EcoR1 pRL mETP SpyTag Stop Xho1 Double Digestion(EcoR1,Xho1)

Insignia of the Second Investigation Department (Lithuania).png

------------------------------------------------------------------------------------------

Midi-prep &Transfection

 

 

1.Opti-MEM+ DNA(each: 3ug)= 250ul
2.(Opti-MEM 241ul+TR 9ul)*2 master mix (vortex well)
3.Put 2 into 1 250ul per each & mix(1min) , stand 30min
4.Treat #3 to H-293 Cell, media change after 10hours
5.Change media to serum free (starvation) Media change after 1day (Check GFP signal)
6.Prepare lysate after 2days(between 24~48hours) (check whether plasmid is well overexpressed by western blot)
7.Put Media 520ul per each in e.tube and 4 celcius 13000rpm, 1min centrifuge, get 500ul of each centrifuged into column and do 45min 13000rpm, 4celcius centrifuge

(Media = conditioned media(CM))

* Store rest of media는 in other tube (labeling)

8. Wash rest of cell in 1X PBS(cold) and after wash, do suction

9. Treat Lysis buffer 200ul and scrape using stripper. Collect all of them in E.tube & labeling, incubation 10 min in cold ice, then 15min 13000rpm, 4celcius centrifuge

(After sup media of centrifuged = cell extract(TCE))

 

Transfection

 

 

1.Opti-MEM+ DNA(each: 3ug)= 250ul
2.(Opti-MEM 241ul+TR 9ul)*2 master mix (vortex well)
3.Put 2 into 1 250ul per each & mix(1min) , stand 30min
4.Treat #3 to H-293 Cell, media change after 10hours
5.Change media to serum free (starvation) Media change after 1day (Check GFP signal)
6.Prepare lysate after 2days(between 24~48hours) (check whether plasmid is well overexpressed by western blot)
7.Put Media 520ul per each in e.tube and 4 celcius 13000rpm, 1min centrifuge, get 500ul of each centrifuged into column and do 45min 13000rpm, 4celcius centrifuge

(Media = conditioned media(CM))

* Store rest of media는 in other tube (labeling)

8. Wash rest of cell in 1X PBS(cold) and after wash, do suction

9. Treat Lysis buffer 200ul and scrape using stripper. Collect all of them in E.tube & labeling, incubation 10 min in cold ice, then 15min 13000rpm, 4celcius centrifuge

(After sup media of centrifuged = cell extract(TCE))

 

Western Blot

Ex1.png

tx621(anti-mETP) - (mETP-spytag CM, TCE)

 

pRA-mETP-SpyTag Size Exclusion  

400px

 

(2)pTrc-Spe1-SpyCatcher-Xho1-APEX2

(E.Coli expression vector)

 

(3) pTrc-Spe1-mETP-Xho1-APEX2

(E.Coli expression vector)

 

(2) pTrc-Spe1-SpyCatcher-Xho1-APEX2 (E.Coli expression vector)

- APEX2 Sequence(318bp, 26.38kda)

Cgaaagtcttacccaactgtgagtgctgattaccaggacgccgttgagaaggcgaagaagaagctcagaggcttcatcgctgagaagagatgcgctcctctaatgctccgtttggcattccactctgctggaacctttgacaagggcacgaagaccggtggacccttcggaaccatcaagcaccctgccgaactggctcacagcgctaacaacggtcttgacatcgctgttaggcttttggagccactcaaggcggagttccctattttgagctacgccgatttctaccagttggctggcgttgttgccgttgaggtc

- SpyCatcher(385bp, 31.36kda)

ATGGTTGATACCTTATCAGGTTTATCAAGTGAGCA

AGGTCAGTCCGGTGATATGACAATTGAAGAAGATAGTGCTACCCATATTAAATTCTCAAAACGTGATGAG

GACGGCAAAGAGTTAGCTGGTGCAACTATGGAGTTGCGTGATTCATCTGGTAAAACTATTAGTACATGGA

TTTCAGATGGACAAGTGAAAGATTTCTACCTGTATCCAGGAAAATATACATTTGTCGAAACCGCAGCACC

AGACGGTTATGAGGTAGCAACTGCTATTACCTTTACAGTTAATGAGCAAGGTCAGGTTACTGTAAATGGC

AAAGCAACTAAAGGTGACGCTCATATTTAAATGGTTGATGCTTGAGGATCCGAATTCGAGCTCCGTCGAC

400px

 

(2) pTrc-Spe1-SpyCatcher-Xho1-APEX2 (E.Coli expression vector) sequencing data

400px

*pTRC sequencing primer

F: 5’-AGCTGTTGACAATTAATCATCCGGC-3’

R: 5'-TCTGCGTTCTGATTTAATCTGTATCAGGC-3‘

 

(2)pTRC_APEX2_SpyCatcherSpe1Xho1(Spe1-SpyCatcher-Xho1)

400px

(3) pTrc-Spe1-mETP-Xho1-APEX2(39.1kda) expected sequence

400px

 

(3) pTrc-Spe1-mETP-Xho1-APEX2 (E.Coli expression vector)

1.Add Spe1, Xho1 between mETP

 

PCR(Ex-Nrg1)

-TDW :37.75ul

-10X EX Taq Buffer : 5ul

-Primer(R/F):  1ul(per each)

-Template(mETP): 1ul(10ng) -----------X4(temperature gradient: 54,56,58,60)

-2.5mM dNTP MIX: 4ul

-Ex Taq Polymerase: 0.25ul

------------------------------

                        50ul

 

Purify

 

-Use mini-prep kit

 (PW buffer 650ul, product 50ul in column, 30sec centrifuge, discard bottom one and 1min centrifuge, transfer column to1.5ml tube, 2nd D.W 35ml , stand 1min, 1min centrifuge

->purified mETP Ex-Tag PCR product(56,58,60)

400px

mETP(Spe1-mETP-Xho1) ExTaq gradient PCR(54,.56,58,60)

 

<T vector Cloning>

-> mETP Ex-Taq PCR (each end A exists) ligate into T vector(=pGEM-T easy vector, each end T exists), Transformation to E.coli

 

-Ligation

-

->NEB Calculator site(nebiocalculator.net.com/#!/ligation) insert length(mETP =204, primer, total 222bp), vector length(T vector :3015bp), T vector mass

->3:1=> insert 5.522ng

 

-> 2X Rapid Ligation buffer: 5ul

    T vector: 0.5ul

    PCR product(Insert):

    D.W :

T4 DNA Ligase: 1ul

---------------------------------------

   Total: 10ul

1hour RT incubation

 

400px

<Colony PCR>

T.D.W : 14.9

10X Buffer : 2

M13 primer Forward: 0.5

M13 primer Reverse: 0.5

2.5mM dNTP: 1.6

XL-Taq polymerase: 0.5

 

Phusion Colony PCR

 

Replica 4,7

Double Digestion

(1) pTrc Vector(pTrc-Spycatcher-APEX2,3410ng/ul): 5ug(1.5ul)

Enzyme(Spe1, Xho1): each 1.5ul

Buffer(Cutsmart,10X):1ul

T.D.W:4.5ul

------------------------------------------------------

10ul

 

(2) pTrc Vector( expected to be Spycatcher Cut ,15ng/ul): 15ul(225ng)

Enzyme(Spe1, Xho1):  1ul(each)

Buffer(Cutsmart,10X): 2ul

T.D.W:1

------------------------------------------------------

20ul

 

(3) mETP T-vector

-> Restriction Enzyme(Spe1, Xho1): 1.5ul 씩

-> Tvector(735ng/ul): 6.8ul(5ng)

-> 10X Buffer: 2ul

-> T.D.W: 8.2ul

--------------------------------------------------

 20ul

 

37 celcius incubation

400px

 

Ligation

 

 

-> Insert: 212bp

-> Vector DNA mass: 50ng

-> 3:1

=> Insert DNA mass: 7.227ng

 

10X T4 DNA Ligase buffer: 3ul

Vector DNA: 50ng(17ul)

Insert DNA: 7.227ng(2.06ul)

D.W: 6.94ul

T4 DNA Ligase: 1ul

---------------------------------------------------------------

Total: 30ul

RT incubation

 

->Transformation

 

-> Colony: 4

-> incubation

->Mini-prep

-> 1.5% gel, 4 Digestion

400px

pTrc Spe1-mETP-Xho1 colony(1,2,3,4)

Double Digestion

 

(3) pTrc-Spe1-mETP-Xho1-APEX2 (E.Coli expression vector) sequencing result

400px

 

(2) pTrc-Spe1-SpyCatcher-Xho1-APEX2 (E.Coli expression vector)

(3) pTrc-Spe1-mETP-Xho1-APEX2 (E.Coli expression vector) sequencing result

 

 

(1)Protein expression by transformation on Ecoli(BL21)

*Store each of E.coli in -80 celcius Deep Freezer

 

(2)Do IPTG induction test(small scale) to check whether it is soluble, overexpress or not

 

(3) Get protein & purify!

 

<Protein induction & soluble test protocol>

 

1.Incubate E.coli with 5ml+antibiotic LB  (previous day)

●

2.Dilute up to 1:50(2%) and incubate with new bottle

●

3.Incuabte until OD(optical density) reach 0.5~0.8  at 600nm. Then, divide it into 1.5ml tube 200ul tube(IPTG(-), store at 4 celcius)

●

4.Treat IPTG(=molecular biology reagent)  (final: 0.5mM/L , 1M*xL = 0.5mM*yL)

Ex:    For 200ml, 100ul 1M IPTG is needed

 

5. Incubate ITPG treated with 37 celcius shaker about 3.5 hours

 

6. Divide it into 1.5ml tube 200ul (14000rpm,1min centrifuge, label IPTG(+) Sup  to Sup(supernatant, Wash the ppt(pallet) with T.D.W 50ul and label it to IPTG(+) PPT and store both with 4 celcius )

 

7. Centrifuge rest of them (4000rpm, 15min) & remove sup

 

8. Resuspension it with Phosphate buffer(=Ni-NTA wash buffer, (20mM Tris HCl(pH 8), 150mM NaCl, 20mM Imidazole))

 

9.  centrifuge, remove sup

10. Resuspension each with (1L: 30~35ml wash buffer )

 

11. Treat Lysozyme(50ul per 1L) and incubate it with shaking (0.5~1h RT)

 

12. sonication(20 amplitude, 10min(processing time : 5min)

 

13. Take 50ul and divide it into ppt&SUP to check solubility

 

14. Centrifuge Rest of them except 50ul with 10000rpm, isolate Sup and ppt. Label each of them with IPTG(+) sonication(+) sup, ppt, IPTG(+) sonication(-) sup, ppt

 

15. Mix Labeled with 5X SDS buffer and boil it with 100 celcius(5~10min)

 

* Store it in -20 celcius

 

pTrc-Spe1-mETP-Xho1-APEX2 protein size

Open reading frame(ORF): 1068bp, 355 amino acids, 39.1kDa

 

Þ10% gel commassie blue(60v->120v)

400px

 

(3) pTrc-Spe1-mETP-Xho1-APEX2 protein his column purification

(E.Coli expression vector)

400px

 

His column purification Comassie blue staining

400px

(3) pTrc-Spe1-mETP-Xho1-APEX2 protein

 

#19 size exclusion(purification)

400px

(3) pTrc-Spe1-mETP-Xho1-APEX2 protein

 

(1)pRA-GFP-pRL-mETP-SpyTag-Stop-Xho1 (mammalian expression vector)

& (2) pTrc-Spe1-SpyCatcher-Xho1-APEX2

(E.Coli expression vector) 

Binding test

(protein to protein)

400px 400px 

* pRA-mETP-SpyTag_CM 10ul(concentrated)

pTrc-Spycatcher 200ng, 500ng, 100ng, 200ng, 500ng, 1000ng

 binding test(Anti His) (15%)

* pRA-mETP-SpyTag_CM 10ul(concentrated)

pTrc-Spycatcher 200ng, 500ng, 100ng, 200ng, 500ng, 1000ng

binding test(Anti mETP(Tx621))(15%)

 

Further study & Prospect

 

-Do protein interaction experiment in cell to see whether it is well connected in vitro

-

-

-Find the protein that is correlated with mETP through ‘mass spectroscopy’ technique

 

    -> Therefore, we can identify unknown ‘protein’ and its gene and their location.

 

-Applied to Genomics

   

  -> Analyze how different, how overexpressed, how different of unknown ‘protein’ gene between obese people to lean people by genome sequencing of certain region of unknown ‘protein’ gene

 

 

Reference

 

-   Definition of Proteomics http://biolecture.org/index.php/Proteomics

-   Definition of Omics http://biolecture.org/index.php/Omics

-Bhak, J. (2016, 6 13). Openfree biolecture. Retrieved from Openfree biolecture: http://biolecture.org/index.php/SELF:_Self_evaluating_learning_framework

-Endotrophin triggers adipose tissue fibrosis and metabolic dysfunction. https://www.ncbi.nlm.nih.gov/pubmed/24647224

-Adipocyte-derived endotrophin promotes malignant tumor progression

https://www.jci.org/articles/view/63930

-Secrets of a covalent interaction for biomaterials and biotechnology: SpyTag and SpyCatcher.

https://www.ncbi.nlm.nih.gov/pubmed/26517567

-Directed evolution of APEX2 for electron microscopy and proximity labeling.

https://www.ncbi.nlm.nih.gov/pubmed/25419960

-From genomics to proteomics (Nature Review)

http://www.nature.com/nature/journal/v422/n6928/full/nature01510.html

-Innovation: Metabolomics: the apogee of the omics trilogy

http://www.nature.com/nrm/journal/v13/n4/abs/nrm3314.html

-Mass-spectrometric exploration of proteome structure and function

http://www.nature.com/nature/journal/v537/n7620/abs/nature19949.html

 

------------------------------------------------------------

20131571 조우빈

Retrieved from "https://Biolecture.org/index.php?title=Scientific_Experiment&oldid=9985"