Scientific Experiment

 

Obese in Genomics

 

What is Obese?

-Obesity is a medical condition in which excess body fat has accumulated to the extent that it may have a negative effect on health.

 

-People are generally considered obese when their body mass index (BMI), a measurement obtained by dividing a person's weight by the square of the person's height, is over 30 kg/m2 , with the range 25–30 kg/m2 defined as overweight

 

-Obesity increases the likelihood of various diseases, particularly heart disease, type 2 diabetes, obstructive sleep apnea, certain types of cancer, and osteoarthritis.

 

-Obesity is most commonly caused by a combination of excessive food intake, lack of physical activity, and genetic susceptibility.

 

 

Arrangement of basic terms in Genomics

 

What is Genomics?

Genomics is the omics study of genes of individual organisms, populations, and species.

Paradigm of performing biological science that deviates from investigating single genes, their functions, and roles.

 

What is Omics?

General term for a broad discipline of science and engineering

Analyzing the interactions of biological information objects in various omes in biology

Main focus

1)mapping information objects such as genes and proteins

2)finding interaction relationships among the objects

3)engineering the networks and objects to understand and manipulate the regulatory mechanisms

 

 

What is Proteomics?

 

Omics study of proteins, particularly their structures, sequences, and functions.

   (which proteins interact)

 

The set of proteins produced by it during its life, and its genome is its set of genes.

 

A proteome differs from cell to cell and constantly changes through its biochemical interactions with the genome and the environment.

=> One organism has radically different protein expression in different parts of its body, different stages of its life cycle and different environmental conditions

*There are far fewer protein-coding genes in the human genome than proteins in the human proteome (20,000 to 25,000 genes vs. > 500,000 proteins)

=> Protein diversity is thought to be due to alternative splicing and post-translational modification of proteins

 

New methods include protein microarrays, immunoaffinity chromatography followed by mass spectrometry(MALDI-TOF mass spectrometry), and combinations of experimental methods such as phage display and computational methods.

 

What is Metabolome?

 

Interaction between an organism’s genome and its environment

 

Complete set of small-molecule chemicals found within a biological sample.

 

The small molecule chemicals found in a given metabolome may include both endogenous metabolites that are naturally produced by an organism as well as exogenous chemicals

 

The endogenous metabolome

-> primary metabolome

-> Secondary metabolome

 

* primary metabolite is directly involved in the normal growth, development, and reproduction.

*secondary metabolite is not directly involved in those processes, but usually has important ecological function(ex: pigments, antibiotics or waste products derived from partially metabolized xenobiotics)

Use NMR spectroscopy and mass spectrometry.

 

 

The Human Metabolome Database

 

Contain detailed data on more than 40,000 metabolites that have already been identified or are likely to be found in the human body

 

1)Chemical information

- includes >40,000 metabolite structures with detailed descriptions, extensive chemical classifications, synthesis information and observed/calculated chemical properties

 

2)Clinical information

- includes data on >10,000 metabolite-biofluid concentrations, metabolite concentration information on more than 600 different human diseases and pathway data for more than 200 different inborn errors of metabolism.

 

 

3)Biochemical information.

- includes nearly 6000 protein (and DNA) sequences and more than 5000 biochemical reactions that are linked to these metabolite entries

 

---------------------------------------------

Obese

 

-> Mainly Influenced by External effects!

-> The Disease that can be cured!

-> Obese parents usually have obese children!

 

Therefore, Focus more on protemoics, Metabolome!

 -----------------------------------------------------------------------

Adipose tissue

 

-> Adipokine

   -> Adipose tissue secreted multiple mediator

   -> Passed through either endocrine or paracrine

       Ex: Hormone: leptin, adiponectin

 

-> Adiponectin

    -> Adipocyte-secreted adipokine

    -> Increase lipid oxidation& anti-inflammatory, insulin-sensitizing,  angiogenic action

    => Anti obesity & Antidiabetic, Decrease insulin resistance 

 400px

 

 

 400px

-> Illustration of the major physiological and metabolic

processes with which adipose tissue is involved through the secretion

of various adipokines from adipocytes. The interactions may be

autocrine, paracrine, or endocrine.

 

<Searching Scientific Reports>

 400px

 400px

 

<What is Col6?>

- COL6 = Collagen type 6

- Abundant constituent of white adipose tissue (WAT)

- COL6 levels positively correlate with hyperglycaemia and insulin resistance

- Composed of three distinct a chains, a1, a2 and a3.(COL6 trimeric building block) and are subsequently secreted into the ECM

 

<What is a3 Chain?>

-> longest of the three chains

- contains an unusually long N terminus and a globular C5 domain at the C-terminus

 

-> C-terminal portion of the a3 subunit is cleaved off during the post-translational processing of COL6 fibrils(COL6a3, Endotrophin)

 

<What is Endotrophin?>

- Adipokine with potent tumour-promoting effects

- Plays a pivotal role in shaping a metabolically unfavorable microenvironment in adipose tissue during consumption of a high-fat diet (HFD)

- Powerful co-stimulator of pathologically relevant pathways within the ‘unhealthy’ adipose tissue milieu, triggering fibrosis and inflammation and ultimately leading to enhanced insulin resistance& metabolic dysfunction.

- Exerts a major influence in adipose tissue

- Endotrophin within the tumor microenvironment serves as a major mediator of COL6-stimulated mammary tumor growth and subsequent chemo resistance

- Stimulates fibrosis, activates endothelial cell migration and promotes macrophage infiltration into growing solid tumors.

=> elevated mammary tumor expansion and more pronounced metastatic growth

 400px

---------------------------------------------------------

Problem!

 

-> Don’t know the mechanism of how ETP works.

 

What I’m going to do!

 

-> Find the Receptor according to the New method of Protemoics.

-> Find the interaction, relationship and mechanisms how they act.(Study of Omics)

 -> Omics could be applied to genomics perspective!

400px

 

mETP(204bp, 16.43kda)

ACAGAACCATTGTTTCTCACTAAAACAGATATATGTAAGCTGTCCAGAGATGCTGGGACTT

GTGTGGACTTCAAGTTACTATGGCACTATGACCTAGAGAGCAAAAGTTGCAAGAGATTCTG

GTATGGAGGTTGTGGAGGCAACGAGAACAGATTCCACTCCCAGGAAGAATGTGAAAAGATGTGTAGTCCTGAGTTAACAGTT

 

SpyTag(39bp, 16.43kda)

GCCCACATCGTGATGGTGGACGCCTACAAGCCGACGAAG

 

pRL(90bp, 7.48kda)

ATGGACAGCAAAGGTTCGTCGCAGAAAGGGTCCCGCCTGCTCCTGCTGCTGGTGGTGTCAAATCTACTCTTGTGCCAGGGTGTGGTCTCC

 

(1)

 600px

 pRA-GFP-EcoR1-pRL-unknown-mETP-SpyTag-Stop

 

-> How to make this cloning?

(1)By Using pRL-EcoR1 forward primer, mETP-SpyTag-Stop-Xho1 primer, make pRL-EcoR1-mETP-SpyTag-Stop-Xho1 by Ex-Tag PCR

500px

(2) Insert template gained from (1) in T-Vector to check whether it is really pRL-EcoR1-mETP-SpyTag-Stop-Xho1 or not.

(3) Use EcoR1, Xho1 Digestion enzyme to double digest T vector

(4) Double Digest pRA GFP vector(empty vector) and purify it.

(5) ligate (3), (4) product

 

-> Detailed on Each Steps

(1) Ex-Tag PCR process

 

->Template(pRA-GFP, 20ng): 1ul

->Primer: 1,1ul

->dNTP(10nM): 1ul

->10X Ex-Tag Buffer: 2.5ul

-> Ex-Tag polymerase: 1ul

-> D.W: 17.5ul

----------------------------------------

Total: 25ul

 

PCR

->Temperature Gradient : 54,56,58

->98 celsius : 2min

->98 celsius : 10sec

->57 celsius : 30sec

->72 celsius : 30sec(insert 300bp)

->72 celsius : 5min

X35

 400px

-> Can see the insert(300bp) in both 54,56,58 temperature gradient!

 

 (2)

<T vector ligation>

Insert DNA mass: 8.607ng(3:1)

2X Rapid ligation: 5ul

T vector: 0.5ul(25ng)

PCR product: 1ul(8.7ng)

D.W: 2.5ul

T4 DNA Ligase: 1ul

----------------------------

Total: 10ul

RT 1 hour incubation

Then, Transformation

 

<Colony PCR>

-> Check whether insert base pairs is inserted in T vector well

T.D.W : 14.9

10X Buffer : 2

M13 primer Forward: 0.5

M13 primer Reverse: 0.5

2.5mM dNTP: 1.6

XL-Taq polymerase: 0.5

 ---------------------------------

Can check on 3,5 well(T vector 200bp+ 346bp = 500~600bp)

 

 (3)

EcoR1 pRL mETP SpyTag Stop Xho1(3,5), pRA_GFP Digestion(EcoR1,Xho1)

 400px

pRA_GFP Digestion(EcoR1,Xho1) EcoR1 pRL mETP SpyTag Stop Xho1(3,5) Extraction

 

 (4)

EcoR1 pRL mETP SpyTag Stop Xho1 Tvector&pRA_GFP_mETP&pRA_GFP Digestion(EcoR1,Xho1)

400px

 

(5)

<Ligation>

EcoR1_pRL_mETP_SpyTag_Stop_Xho1 T-Vector

-> insert(9.3ng/ul): 1.5ul

-> vector(19.3ng/ul): 3ul

-> T4 DNA ligase Buffer: 1ul

-> T4 DNA Enzyme: 1ul

-> D.W: 3.5

Transformation

 

pRA_GFP EcoR1 pRL mETP SpyTag Stop Xho1 Double Digestion(EcoR1,Xho1)

------------------------------------------------------------------------------------------

 

 

 

 

 

------------------------------------------------------------

20131571 조우빈