View source for Scientific Experiment

<p>&nbsp;</p>

<p><strong>Obese in Genomics</strong></p>

<p>&nbsp;</p>

<p><strong>What is Obese?</strong></p>

<div>-Obesity is a <a href="https://en.wikipedia.org/wiki/Medical_condition">medical condition</a> in which excess <a href="https://en.wikipedia.org/wiki/Body_fat">body fat</a> has accumulated to the extent that it may have a negative effect on health.</div>

<div>&nbsp;</div>

<div>-People are generally considered obese when their <a href="https://en.wikipedia.org/wiki/Body_mass_index">body mass index</a> (BMI), a measurement obtained by dividing a person&#39;s weight by the square of the person&#39;s height, is over 30&nbsp;<a href="https://en.wikipedia.org/wiki/Kilogram">kg</a>/<a href="https://en.wikipedia.org/wiki/Square_metre">m</a><a href="https://en.wikipedia.org/wiki/Square_metre">2</a> , with the range 25&ndash;30&nbsp;<a href="https://en.wikipedia.org/wiki/Kilogram">kg</a>/<a href="https://en.wikipedia.org/wiki/Square_metre">m</a><a href="https://en.wikipedia.org/wiki/Square_metre">2</a> defined as <a href="https://en.wikipedia.org/wiki/Overweight">overweight</a></div>

<div>&nbsp;</div>

<div>-Obesity increases the likelihood of <a href="https://en.wikipedia.org/wiki/Obesity-associated_morbidity">various diseases</a>, particularly <a href="https://en.wikipedia.org/wiki/Cardiovascular_diseases">heart disease</a>, <a href="https://en.wikipedia.org/wiki/Diabetes_mellitus_type_2">type 2 diabetes</a>, <a href="https://en.wikipedia.org/wiki/Obstructive_sleep_apnea">obstructive sleep apnea</a>, certain types of <a href="https://en.wikipedia.org/wiki/Cancer">cancer</a>, and <a href="https://en.wikipedia.org/wiki/Osteoarthritis">osteoarthritis</a>.</div>

<div>&nbsp;</div>

<div>-Obesity is most commonly caused by a combination of excessive <a href="https://en.wikipedia.org/wiki/Food_energy">food</a> intake, lack of physical activity, and <a href="https://en.wikipedia.org/wiki/Polygenic_inheritance">genetic susceptibility</a>.</div>

<div>&nbsp;</div>

<div>
<p>&nbsp;</p>

<p><strong>Arrangement of basic terms&nbsp;in Genomics</strong></p>

<p>&nbsp;</p>

<p><strong>What is Genomics?</strong></p>
</div>

<p>Genomics is the <a href="http://biopedia.org/index.php/Omics">omics</a> study of <a href="http://biopedia.org/index.php/Gene">genes</a> of individual organisms,&nbsp;populations, and <a href="http://biopedia.org/index.php/Species">species</a>.</p>

<p>Paradigm of performing biological science that deviates from&nbsp;investigating single genes, their functions, and roles.</p>

<p>&nbsp;</p>

<p><strong>What is Omics?</strong></p>

<p>General term for a broad discipline of science and engineering</p>

<p>Analyzing the interactions of biological information objects in various&nbsp;<a href="http://omics.org/index.php?title=Omes&amp;action=edit">omes</a> in biology</p>

<p><strong>Main focus</strong></p>

<div>1)mapping information objects such as genes and proteins</div>

<div><strong><u>2)finding interaction relationships among the objects</u></strong></div>

<div>3)engineering the networks and objects to understand and manipulate the regulatory mechanisms</div>

<div>&nbsp;</div>

<div>&nbsp;</div>

<div><strong>What is Proteomics?</strong></div>

<div>&nbsp;</div>

<div>
<p>Omics study of&nbsp;proteins, particularly their structures, sequences,&nbsp;and functions.</p>

<p>&nbsp;&nbsp; (which proteins interact)</p>

<p>&nbsp;</p>

<p>The set of proteins produced by it during its life, and its genome is its set of genes.</p>

<p>&nbsp;</p>

<p>A proteome differs from cell to cell and constantly changes through its biochemical interactions with the genome and the environment.</p>

<p>=&gt; One organism has radically different protein expression in different parts of its body, different stages of its life cycle and different environmental conditions</p>

<p>*There are far fewer protein-coding genes in the human genome than proteins in the human proteome (20,000 to 25,000 genes vs. &gt; 500,000 proteins)</p>

<p>=&gt; Protein diversity is thought to be due to alternative splicing and post-translational modification of proteins</p>

<p>&nbsp;</p>

<p>New methods include protein microarrays, <u><strong>immunoaffinity chromatography followed by mass spectrometry(MALDI-TOF mass spectrometry),</strong> </u>and combinations of experimental methods such as phage display and computational methods.</p>

<p>&nbsp;</p>

<p><strong>What is Metabolome?</strong></p>

<p>&nbsp;</p>

<p>Interaction between an organism&rsquo;s genome and its environment</p>

<p>&nbsp;</p>

<p>Complete set of <a href="https://en.wikipedia.org/wiki/Small_molecule">small-molecule</a> chemicals found within a biological sample.</p>

<p>&nbsp;</p>

<p>The <a href="https://en.wikipedia.org/wiki/Small_molecule">small molecule</a> chemicals found in a given metabolome may include both endogenous <a href="https://en.wikipedia.org/wiki/Metabolites">metabolites</a> that are naturally produced by an <a href="https://en.wikipedia.org/wiki/Organism">organism</a> as well as exogenous chemicals</p>

<p>&nbsp;</p>

<p><strong>The endogenous metabolome</strong></p>

<p>-&gt; primary metabolome</p>

<p>-&gt; Secondary metabolome</p>

<p>&nbsp;</p>

<p><a href="https://en.wikipedia.org/wiki/Primary_metabolite">* primary metabolite</a> is directly involved in the normal growth, development, and reproduction.</p>

<p><a href="https://en.wikipedia.org/wiki/Secondary_metabolite">*secondary metabolite</a> is not directly involved in those processes, but usually has important ecological function(ex: <a href="https://en.wikipedia.org/wiki/Pigments">pigments</a>, <a href="https://en.wikipedia.org/wiki/Antibiotics">antibiotics</a> or waste products derived from partially metabolized <a href="https://en.wikipedia.org/wiki/Xenobiotics">xenobiotics</a>)</p>

<p><a href="https://en.wikipedia.org/wiki/NMR_spectroscopy">Use NMR spectroscopy</a> and <a href="https://en.wikipedia.org/wiki/Mass_spectrometry">mass spectrometry</a>.</p>

<p>&nbsp;</p>

<p>&nbsp;</p>

<p><strong>The Human Metabolome Database</strong></p>

<p>&nbsp;</p>

<p>Contain detailed data on more than 40,000 metabolites that have already been identified or are likely to be found in the human body</p>

<p>&nbsp;</p>

<div>1)Chemical information</div>

<p>- includes &gt;40,000 metabolite structures with detailed descriptions, extensive chemical classifications, synthesis information and observed/calculated chemical properties</p>

<div>&nbsp;</div>

<div>2)Clinical information</div>

<p>- includes data on &gt;10,000 <a href="https://en.wikipedia.org/wiki/Metabolite">metabolite</a>-<a href="https://en.wikipedia.org/wiki/Biofluid">biofluid</a> concentrations, metabolite concentration information on more than 600 different human diseases and pathway data for more than 200 different inborn errors of metabolism.</p>

<div>&nbsp;</div>

<div>&nbsp;</div>

<div>3)Biochemical information.</div>

<p>- includes nearly 6000 protein (and DNA) sequences and more than 5000 biochemical reactions that are linked to these metabolite entries</p>
</div>

<p>&nbsp;</p>

<p>---------------------------------------------</p>

<p>Obese</p>

<p>&nbsp;</p>

<p>-&gt; Mainly Influenced by External effects!</p>

<p>-&gt; The Disease that can be cured!</p>

<p>-&gt; Obese parents usually have obese children!</p>

<p>&nbsp;</p>

<p><strong><u>Therefore, Focus more on protemoics, Metabolome!</u></strong></p>

<p>&nbsp;-----------------------------------------------------------------------</p>

<p><strong><span style="font-size:14px">Adipose tissue</span></strong></p>

<p>&nbsp;</p>

<p><strong>-&gt; Adipokine </strong></p>

<p>&nbsp;&nbsp; -&gt; <span style="font-size:12px"><span style="color:black; font-family:맑은 고딕">Adipose tissue secreted multiple mediator</span></span></p>

<p><span style="font-size:12px"><span style="color:black; font-family:맑은 고딕">&nbsp;&nbsp;&nbsp;</span></span>-&gt; Passed through either endocrine or paracrine</p>

<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Ex: Hormone: leptin, adiponectin</p>

<p>&nbsp;</p>

<p><strong>-&gt; Adiponectin</strong></p>

<p><strong>&nbsp;&nbsp;&nbsp; -&gt; </strong>Adipocyte-secreted adipokine</p>

<p>&nbsp;&nbsp;&nbsp; -&gt; Increase lipid oxidation&amp; anti-inflammatory, insulin-sensitizing,&nbsp; angiogenic action</p>

<p>&nbsp;&nbsp;&nbsp; <strong>=&gt; Anti obesity &amp; Antidiabetic, Decrease insulin resistance&nbsp;</strong></p>

<p>&nbsp;[[File:1.png|400px]]</p>

<p>&nbsp;</p>

<p>&nbsp;</p>

<p>&nbsp;[[File:2.gif|400px]]</p>

<p>-&gt; Illustration of the major physiological and metabolic</p>

<p>processes with which adipose tissue is involved through the secretion</p>

<p>of various adipokines from adipocytes. The interactions may be</p>

<p>autocrine, paracrine, or endocrine.</p>

<p>&nbsp;</p>

<p><span style="font-size:16px"><strong>&lt;Searching Scientific Reports&gt;</strong></span></p>

<p>&nbsp;[[File:3.png|400px]]</p>

<p>&nbsp;[[File:4.png|400px]]</p>

<p>&nbsp;</p>

<p><strong><span style="font-size:16px">&lt;What is Col6?&gt;</span></strong></p>

<p>- COL6 = Collagen type 6</p>

<p>- Abundant constituent of white adipose tissue (WAT)</p>

<p>- COL6 levels positively correlate with hyperglycaemia and insulin resistance</p>

<p>- Composed of three distinct a chains, a1, a2 and a3.(COL6 trimeric building block) and are subsequently secreted into the ECM</p>

<p>&nbsp;</p>

<p><strong><span style="font-size:16px">&lt;What is a3 Chain?&gt;</span></strong></p>

<p>-&gt; longest of the three chains</p>

<p>- contains an unusually long N terminus and a globular C5 domain at the C-terminus</p>

<p>&nbsp;</p>

<p>-&gt; C-terminal portion of the a3 subunit is cleaved off during the post-translational processing of COL6 fibrils(COL6a3, Endotrophin)</p>

<p>&nbsp;</p>

<p><strong><span style="font-size:16px">&lt;What is Endotrophin?&gt;</span></strong></p>

<p>- Adipokine with potent tumour-promoting effects</p>

<p>- Plays a pivotal role in shaping a metabolically unfavorable microenvironment in adipose tissue during consumption of a high-fat diet (HFD)</p>

<p>- Powerful co-stimulator of pathologically relevant pathways within the &lsquo;unhealthy&rsquo; adipose tissue milieu, triggering fibrosis and inflammation and ultimately leading to enhanced insulin resistance&amp; metabolic dysfunction.</p>

<p>- Exerts a major influence in adipose tissue</p>

<p>- Endotrophin within the tumor microenvironment serves as a major mediator of COL6-stimulated mammary tumor growth and subsequent chemo resistance</p>

<p>- Stimulates fibrosis, activates endothelial cell migration and promotes macrophage infiltration into growing solid tumors.</p>

<p>=&gt; elevated mammary tumor expansion and more pronounced metastatic growth</p>

<p>&nbsp;[[File:5.png|400px]]</p>

<p>---------------------------------------------------------</p>

<p><u><strong><span style="font-size:18px">Problem!</span></strong></u></p>

<p>&nbsp;</p>

<p><strong>-&gt; Don&rsquo;t know the mechanism of how ETP works.</strong></p>

<p>&nbsp;</p>

<p><u><strong><span style="font-size:16px">What I&rsquo;m going to do!</span></strong></u></p>

<p>&nbsp;</p>

<div><strong>-&gt; Find the Receptor according to the New method of Protemoics.</strong></div>

<div><strong>-&gt; Find the interaction, relationship and mechanisms how they act.(Study of Omics)</strong></div>

<div><u><strong>&nbsp;-&gt; Omics could be applied to genomics perspective!</strong></u></div>

<p>[[File:Self1.png|400px]]</p>

<p>&nbsp;</p>

<p>mETP(204bp, 16.43kda)</p>

<p>ACAGAACCATTGTTTCTCACTAAAACAGATATATGTAAGCTGTCCAGAGATGCTGGGACTT</p>

<p>GTGTGGACTTCAAGTTACTATGGCACTATGACCTAGAGAGCAAAAGTTGCAAGAGATTCTG</p>

<p>GTATGGAGGTTGTGGAGGCAACGAGAACAGATTCCACTCCCAGGAAGAATGTGAAAAGATGTGTAGTCCTGAGTTAACAGTT</p>

<p>&nbsp;</p>

<p>SpyTag(39bp, 16.43kda)</p>

<p>GCCCACATCGTGATGGTGGACGCCTACAAGCCGACGAAG</p>

<p>&nbsp;</p>

<p>pRL(90bp, 7.48kda)</p>

<p>ATGGACAGCAAAGGTTCGTCGCAGAAAGGGTCCCGCCTGCTCCTGCTGCTGGTGGTGTCAAATCTACTCTTGTGCCAGGGTGTGGTCTCC</p>

<p>&nbsp;</p>

<p>(1)</p>

<p>&nbsp;[[File:12.png|600px]]</p>

<p>&nbsp;pRA-GFP-EcoR1-pRL-unknown-mETP-SpyTag-Stop</p>

<p>&nbsp;</p>

<p>-&gt;<strong> How to make this cloning?</strong></p>

<p>(1)By Using pRL-EcoR1 forward primer, mETP-SpyTag-Stop-Xho1 primer, make pRL-EcoR1-mETP-SpyTag-Stop-Xho1 by Ex-Tag PCR</p>

<p>[[File:13.png|500px]]</p>

<p>(2) Insert template gained from (1) in T-Vector to check whether it is really pRL-EcoR1-mETP-SpyTag-Stop-Xho1&nbsp;or not.</p>

<p>(3) Use EcoR1, Xho1 Digestion enzyme to double digest T vector</p>

<p>(4) Double Digest pRA GFP vector(empty vector) and purify it.</p>

<p>(5) ligate (3), (4) product</p>

<p>&nbsp;</p>

<p><strong>-&gt; Detailed on Each Steps</strong></p>

<p>(1) Ex-Tag PCR process</p>

<p>&nbsp;</p>

<p>-&gt;Template(pRA-GFP, 20ng): 1ul</p>

<p>-&gt;Primer: 1,1ul</p>

<p>-&gt;dNTP(10nM): 1ul</p>

<p>-&gt;10X Ex-Tag Buffer: 2.5ul</p>

<p>-&gt; Ex-Tag polymerase: 1ul</p>

<p>-&gt; D.W: 17.5ul</p>

<p>----------------------------------------</p>

<p>Total: 25ul</p>

<p>&nbsp;</p>

<p>PCR</p>

<p>-&gt;Temperature Gradient : 54,56,58</p>

<p>-&gt;98 celsius : 2min</p>

<p>-&gt;98 celsius : 10sec</p>

<p>-&gt;57 celsius : 30sec</p>

<p>-&gt;72 celsius&nbsp;: 30sec(insert 300bp)</p>

<p>-&gt;72 celsius : 5min</p>

<p>X35</p>

<p>&nbsp;[[File:14.png|400px]]</p>

<p>-&gt; Can see the insert(300bp) in both 54,56,58 temperature gradient!</p>

<p>&nbsp;</p>

<p>&nbsp;(2)</p>

<p>&lt;T vector ligation&gt;</p>

<p>Insert DNA mass: 8.607ng(3:1)</p>

<p>2X Rapid ligation: 5ul</p>

<p>T vector: 0.5ul(25ng)</p>

<p>PCR product: 1ul(8.7ng)</p>

<p>D.W: 2.5ul</p>

<p>T4 DNA Ligase: 1ul</p>

<p>----------------------------</p>

<p>Total: 10ul</p>

<p>RT 1 hour incubation</p>

<p>Then, Transformation</p>

<p>&nbsp;</p>

<p>&lt;Colony PCR&gt;</p>

<p>-&gt; Check whether insert base pairs is inserted in T vector well</p>

<p>T.D.W : 14.9</p>

<p>10X Buffer : 2</p>

<p>M13 primer Forward: 0.5</p>

<p>M13 primer Reverse: 0.5</p>

<p>2.5mM dNTP: 1.6</p>

<p>XL-Taq polymerase: 0.5</p>

<p>&nbsp;---------------------------------</p>

<p>[[File:15.jpg|400px]]</p>

<p>Can check on 3,5 well(T vector 200bp+ 346bp = 500~600bp)</p>

<p>&nbsp;</p>

<p>&nbsp;(3)</p>

<p>EcoR1 pRL mETP SpyTag Stop Xho1(3,5), pRA_GFP Digestion(EcoR1,Xho1)</p>

<p>&nbsp;[[File:17.png|400px]]</p>

<p>pRA_GFP Digestion(EcoR1,Xho1) EcoR1 pRL mETP SpyTag Stop Xho1(3,5) Extraction</p>

<p>&nbsp;</p>

<p>&nbsp;(4)</p>

<p>EcoR1 pRL mETP SpyTag Stop Xho1 Tvector&amp;pRA_GFP_mETP&amp;pRA_GFP Digestion(EcoR1,Xho1)</p>

<p>[[File:18.png|400px]]</p>

<p>&nbsp;</p>

<p>(5)</p>

<p>&lt;Ligation&gt;</p>

<p>EcoR1_pRL_mETP_SpyTag_Stop_Xho1 T-Vector</p>

<p>-&gt; insert(9.3ng/ul): 1.5ul</p>

<p>-&gt; vector(19.3ng/ul): 3ul</p>

<p>-&gt; T4 DNA ligase Buffer: 1ul</p>

<p>-&gt; T4 DNA Enzyme: 1ul</p>

<p>-&gt; D.W: 3.5</p>

<p>Transformation</p>

<p>&nbsp;</p>

<p>pRA_GFP EcoR1 pRL mETP SpyTag Stop Xho1 Double Digestion(EcoR1,Xho1)</p>

<p>[[File:19.png|400px]]</p>

<p>------------------------------------------------------------------------------------------</p>

<p>Midi-prep &amp;Transfection</p>

<p>&nbsp;</p>

<p>&nbsp;</p>

<div>1.Opti-MEM+ DNA(each: 3ug)= 250ul</div>

<div>2.(Opti-MEM 241ul+TR 9ul)*2 master mix (vortex well)</div>

<div>3.Put 2 into 1 250ul per each &amp; mix(1min) , stand 30min</div>

<div>4.Treat #3 to H-293 Cell, media change after 10hours</div>

<div>5.Change media to serum free (starvation) Media change after 1day (Check GFP signal)</div>

<div>6.Prepare lysate after 2days(between 24~48hours) (check whether plasmid is well overexpressed by western blot)</div>

<div>7.Put Media 520ul per each in e.tube and 4 celcius 13000rpm, 1min centrifuge, get 500ul of each centrifuged into column and do 45min 13000rpm, 4celcius centrifuge</div>

<p>(Media = conditioned media(CM))</p>

<p>* Store rest of media는 in other tube (labeling)</p>

<p>8. Wash rest of cell in 1X PBS(cold) and after wash, do suction</p>

<p>9. Treat Lysis buffer 200ul and scrape using stripper. Collect all of them in E.tube &amp; labeling, incubation 10 min in cold ice, then 15min 13000rpm, 4celcius centrifuge</p>

<p>(After sup media of centrifuged = cell extract(TCE))</p>

<p>&nbsp;</p>

<p>Transfection</p>

<p>&nbsp;</p>

<p>&nbsp;</p>

<div>1.Opti-MEM+ DNA(each: 3ug)= 250ul</div>

<div>2.(Opti-MEM 241ul+TR 9ul)*2 master mix (vortex well)</div>

<div>3.Put 2 into 1 250ul per each &amp; mix(1min) , stand 30min</div>

<div>4.Treat #3 to H-293 Cell, media change after 10hours</div>

<div>5.Change media to serum free (starvation) Media change after 1day (Check GFP signal)</div>

<div>6.Prepare lysate after 2days(between 24~48hours) (check whether plasmid is well overexpressed by western blot)</div>

<div>7.Put Media 520ul per each in e.tube and 4 celcius 13000rpm, 1min centrifuge, get 500ul of each centrifuged into column and do 45min 13000rpm, 4celcius centrifuge</div>

<p>(Media = conditioned media(CM))</p>

<p>* Store rest of media는 in other tube (labeling)</p>

<p>8. Wash rest of cell in 1X PBS(cold) and after wash, do suction</p>

<p>9. Treat Lysis buffer 200ul and scrape using stripper. Collect all of them in E.tube &amp; labeling, incubation 10 min in cold ice, then 15min 13000rpm, 4celcius centrifuge</p>

<p>(After sup media of centrifuged = cell extract(TCE))</p>

<p>&nbsp;</p>

<p><span style="font-size:14px">Western Blot</span></p>

<p>[[File:Ex1.png|400px]]</p>

<p>tx621(anti-mETP) - (mETP-spytag CM, TCE)</p>

<p>&nbsp;</p>

<p>pRA-mETP-SpyTag Size Exclusion &nbsp;</p>

<p>[[File:Ex2.jpg|400px]]</p>

<p>&nbsp;</p>

<p>(2)pTrc-Spe1-SpyCatcher-Xho1-APEX2</p>

<p>(E.Coli expression vector)</p>

<p>&nbsp;</p>

<p>(3) pTrc-Spe1-mETP-Xho1-APEX2</p>

<p>(E.Coli expression vector)</p>

<p>&nbsp;</p>

<p>(2) pTrc-Spe1-SpyCatcher-Xho1-APEX2 (E.Coli expression vector)</p>

<p>- APEX2 Sequence(318bp, 26.38kda)</p>

<p>Cgaaagtcttacccaactgtgagtgctgattaccaggacgccgttgagaaggcgaagaagaagctcagaggcttcatcgctgagaagagatgcgctcctctaatgctccgtttggcattccactctgctggaacctttgacaagggcacgaagaccggtggacccttcggaaccatcaagcaccctgccgaactggctcacagcgctaacaacggtcttgacatcgctgttaggcttttggagccactcaaggcggagttccctattttgagctacgccgatttctaccagttggctggcgttgttgccgttgaggtc</p>

<p>- SpyCatcher(385bp, 31.36kda)</p>

<p>ATGGTTGATACCTTATCAGGTTTATCAAGTGAGCA</p>

<p>AGGTCAGTCCGGTGATATGACAATTGAAGAAGATAGTGCTACCCATATTAAATTCTCAAAACGTGATGAG</p>

<p>GACGGCAAAGAGTTAGCTGGTGCAACTATGGAGTTGCGTGATTCATCTGGTAAAACTATTAGTACATGGA</p>

<p>TTTCAGATGGACAAGTGAAAGATTTCTACCTGTATCCAGGAAAATATACATTTGTCGAAACCGCAGCACC</p>

<p>AGACGGTTATGAGGTAGCAACTGCTATTACCTTTACAGTTAATGAGCAAGGTCAGGTTACTGTAAATGGC</p>

<p>AAAGCAACTAAAGGTGACGCTCATATTTAAATGGTTGATGCTTGAGGATCCGAATTCGAGCTCCGTCGAC</p>

<p>[[File:Ex3.jpg|400px]]</p>

<p>&nbsp;</p>

<p>(2) pTrc-Spe1-SpyCatcher-Xho1-APEX2 (E.Coli expression vector) sequencing data</p>

<p>[[File:Ex4.png|400px]]</p>

<p>*pTRC sequencing primer</p>

<p>F: 5&rsquo;-AGCTGTTGACAATTAATCATCCGGC-3&rsquo;</p>

<p>R: 5&#39;-TCTGCGTTCTGATTTAATCTGTATCAGGC-3&lsquo;</p>

<p>&nbsp;</p>

<p>(2)pTRC_APEX2_SpyCatcherSpe1Xho1(Spe1-SpyCatcher-Xho1)</p>

<p>[[File:Ex5.png|400px]]</p>

<p>(3) pTrc-Spe1-mETP-Xho1-APEX2(39.1kda) expected sequence</p>

<p>[[File:Ex6.png|400px]]</p>

<p>&nbsp;</p>

<p>(3) pTrc-Spe1-mETP-Xho1-APEX2 (E.Coli expression vector)</p>

<p>1.Add Spe1, Xho1 between mETP</p>

<p>&nbsp;</p>

<p>PCR(Ex-Nrg1)</p>

<p>-TDW :37.75ul</p>

<p>-10X EX Taq Buffer : 5ul</p>

<p>-Primer(R/F): &nbsp;1ul(per each)</p>

<p>-Template(mETP): 1ul(10ng) -----------X4(temperature gradient: 54,56,58,60)</p>

<p>-2.5mM dNTP MIX: 4ul</p>

<p>-Ex Taq Polymerase: 0.25ul</p>

<p>------------------------------</p>

<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 50ul</p>

<p>&nbsp;</p>

<p>Purify</p>

<p>&nbsp;</p>

<p>-Use mini-prep kit</p>

<p>&nbsp;(PW buffer 650ul, product 50ul in column, 30sec centrifuge, discard bottom one and 1min centrifuge, transfer column to1.5ml tube, 2nd D.W 35ml , stand 1min, 1min centrifuge</p>

<p>-&gt;purified mETP Ex-Tag PCR product(56,58,60)</p>

<p>[[File:Ex7.jpg|400px]]</p>

<p>mETP(Spe1-mETP-Xho1) ExTaq gradient PCR(54,.56,58,60)</p>

<p>&nbsp;</p>

<p>&lt;T vector Cloning&gt;</p>

<p>-&gt; mETP Ex-Taq PCR (each end A exists) ligate into T vector(=pGEM-T easy vector, each end T exists), Transformation to E.coli</p>

<p>&nbsp;</p>

<p>-Ligation</p>

<p>-</p>

<p>-&gt;NEB Calculator site(nebiocalculator.net.com/#!/ligation) insert length(mETP =204, primer, total 222bp), vector length(T vector :3015bp), T vector mass</p>

<p>-&gt;3:1=&gt; insert 5.522ng</p>

<p>&nbsp;</p>

<p>-&gt; 2X Rapid Ligation buffer: 5ul</p>

<p>&nbsp;&nbsp;&nbsp; T vector: 0.5ul</p>

<p>&nbsp;&nbsp;&nbsp; PCR product(Insert):</p>

<p>&nbsp;&nbsp;&nbsp; D.W :</p>

<p>T4 DNA Ligase: 1ul</p>

<p>---------------------------------------</p>

<p>&nbsp;&nbsp; Total: 10ul</p>

<p>1hour RT incubation</p>

<p>&nbsp;</p>

<p>[[File:Ex8.jpg|400px]]</p>

<p>&lt;Colony PCR&gt;</p>

<p>T.D.W : 14.9</p>

<p>10X Buffer : 2</p>

<p>M13 primer Forward: 0.5</p>

<p>M13 primer Reverse: 0.5</p>

<p>2.5mM dNTP: 1.6</p>

<p>XL-Taq polymerase: 0.5</p>

<p>&nbsp;</p>

<p>Phusion Colony PCR</p>

<p>&nbsp;</p>

<p>Replica 4,7</p>

<p>Double Digestion</p>

<p>(1) pTrc Vector(pTrc-Spycatcher-APEX2,3410ng/ul): 5ug(1.5ul)</p>

<p>Enzyme(Spe1, Xho1): each 1.5ul</p>

<p>Buffer(Cutsmart,10X):1ul</p>

<p>T.D.W:4.5ul</p>

<p>------------------------------------------------------</p>

<p>10ul</p>

<p>&nbsp;</p>

<p>(2) pTrc Vector( expected to be Spycatcher Cut ,15ng/ul): 15ul(225ng)</p>

<p>Enzyme(Spe1, Xho1):&nbsp; 1ul(each)</p>

<p>Buffer(Cutsmart,10X): 2ul</p>

<p>T.D.W:1</p>

<p>------------------------------------------------------</p>

<p>20ul</p>

<p>&nbsp;</p>

<p>(3) mETP T-vector</p>

<p>-&gt; Restriction Enzyme(Spe1, Xho1): 1.5ul 씩</p>

<p>-&gt; Tvector(735ng/ul): 6.8ul(5ng)</p>

<p>-&gt; 10X Buffer: 2ul</p>

<p>-&gt; T.D.W: 8.2ul</p>

<p>--------------------------------------------------</p>

<p>&nbsp;20ul</p>

<p>&nbsp;</p>

<p>37 celcius incubation</p>

<p>[[File:Ex9.png|400px]]</p>

<p>&nbsp;</p>

<p>Ligation</p>

<p>&nbsp;</p>

<p>&nbsp;</p>

<p>-&gt; Insert: 212bp</p>

<p>-&gt; Vector DNA mass: 50ng</p>

<p>-&gt; 3:1</p>

<p>=&gt; Insert DNA mass: 7.227ng</p>

<p>&nbsp;</p>

<p>10X T4 DNA Ligase buffer: 3ul</p>

<p>Vector DNA: 50ng(17ul)</p>

<p>Insert DNA: 7.227ng(2.06ul)</p>

<p>D.W: 6.94ul</p>

<p>T4 DNA Ligase: 1ul</p>

<p>---------------------------------------------------------------</p>

<p>Total: 30ul</p>

<p>RT incubation</p>

<p>&nbsp;</p>

<p>-&gt;Transformation</p>

<p>&nbsp;</p>

<p>-&gt; Colony: 4</p>

<p>-&gt; incubation</p>

<p>-&gt;Mini-prep</p>

<p>-&gt; 1.5% gel, 4 Digestion</p>

<p>[[File:Ex10.png|400px]]</p>

<p>pTrc Spe1-mETP-Xho1 colony(1,2,3,4)</p>

<p>Double Digestion</p>

<p>&nbsp;</p>

<p>(3) pTrc-Spe1-mETP-Xho1-APEX2 (E.Coli expression vector) sequencing result</p>

<p>[[File:Ex11.png|400px]]</p>

<p>&nbsp;</p>

<p>(2) pTrc-Spe1-SpyCatcher-Xho1-APEX2 (E.Coli expression vector)</p>

<p>(3) pTrc-Spe1-mETP-Xho1-APEX2 (E.Coli expression vector) sequencing result</p>

<p>&nbsp;</p>

<p>&nbsp;</p>

<p>(1)Protein expression by transformation on Ecoli(BL21)</p>

<p>*Store each of E.coli in -80 celcius Deep Freezer</p>

<p>&nbsp;</p>

<p>(2)Do IPTG induction test(small scale) to check whether it is soluble, overexpress or not</p>

<p>&nbsp;</p>

<p>(3) Get protein &amp; purify!</p>

<p>&nbsp;</p>

<p>&lt;Protein induction &amp; soluble test protocol&gt;</p>

<p>&nbsp;</p>

<p>1.Incubate E.coli with 5ml+antibiotic LB&nbsp; (previous day)</p>

<p>●</p>

<p>2.Dilute up to 1:50(2%) and incubate with new bottle</p>

<p>●</p>

<p>3.Incuabte until OD(optical density) reach 0.5~0.8 &nbsp;at 600nm. Then, divide it into 1.5ml tube 200ul tube(IPTG(-), store at 4 celcius)</p>

<p>●</p>

<p>4.Treat IPTG(=molecular biology reagent) &nbsp;(final: 0.5mM/L , 1M*xL = 0.5mM*yL)</p>

<p>Ex:&nbsp;&nbsp;&nbsp; For 200ml, 100ul 1M IPTG is needed</p>

<p>&nbsp;</p>

<p>5. Incubate ITPG treated with 37 celcius shaker about 3.5 hours</p>

<p>&nbsp;</p>

<p>6. Divide it into 1.5ml tube 200ul (14000rpm,1min centrifuge, label IPTG(+) Sup &nbsp;to Sup(supernatant, Wash the ppt(pallet) with T.D.W 50ul and label it to IPTG(+) PPT and store both with 4 celcius )</p>

<p>&nbsp;</p>

<p>7. Centrifuge rest of them (4000rpm, 15min) &amp; remove sup</p>

<p>&nbsp;</p>

<p>8. Resuspension it with Phosphate buffer(=Ni-NTA wash buffer, (20mM Tris HCl(pH 8), 150mM NaCl, 20mM Imidazole))</p>

<p>&nbsp;</p>

<p>9. &nbsp;centrifuge, remove sup</p>

<p>10. Resuspension each with (1L: 30~35ml wash buffer )</p>

<p>&nbsp;</p>

<p>11. Treat Lysozyme(50ul per 1L) and incubate it with shaking (0.5~1h RT)</p>

<p>&nbsp;</p>

<p>12. sonication(20 amplitude, 10min(processing time : 5min)</p>

<p>&nbsp;</p>

<p>13. Take 50ul and divide it into ppt&amp;SUP to check solubility</p>

<p>&nbsp;</p>

<p>14. Centrifuge Rest of them except 50ul with 10000rpm, isolate Sup and ppt. Label each of them with IPTG(+) sonication(+) sup, ppt, IPTG(+) sonication(-) sup, ppt</p>

<p>&nbsp;</p>

<p>15. Mix Labeled with 5X SDS buffer and boil it with 100 celcius(5~10min)</p>

<p>&nbsp;</p>

<p>* Store it in -20 celcius</p>

<p>&nbsp;</p>

<p>pTrc-Spe1-mETP-Xho1-APEX2 protein size</p>

<p>Open reading frame(ORF): 1068bp, 355 amino acids, 39.1kDa</p>

<p>&nbsp;</p>

<p>&THORN;10% gel commassie blue(60v-&gt;120v)</p>

<p>[[File:Ex12.png|400px]]</p>

<p>&nbsp;</p>

<p>(3) pTrc-Spe1-mETP-Xho1-APEX2 protein his column purification</p>

<p>(E.Coli expression vector)</p>

<p>[[File:Ex13.jpg|400px]]</p>

<p>&nbsp;</p>

<p>His column purification Comassie blue staining</p>

<p>[[File:Ex14.png|400px]]</p>

<p>(3) pTrc-Spe1-mETP-Xho1-APEX2 protein</p>

<p>&nbsp;</p>

<p>#19 size exclusion(purification)</p>

<p>[[File:Ex15.jpg|400px]]</p>

<p>(3) pTrc-Spe1-mETP-Xho1-APEX2 protein</p>

<p>&nbsp;</p>

<p>(1)pRA-GFP-pRL-mETP-SpyTag-Stop-Xho1 (mammalian expression vector)</p>

<p>&amp;&nbsp;(2) pTrc-Spe1-SpyCatcher-Xho1-APEX2</p>

<p>(E.Coli expression vector)&nbsp;</p>

<p>Binding test</p>

<p>(protein to protein)</p>

<p>[[File:Ex16.png|400px]]&nbsp;[[File:Ex17.jpg|400px]]&nbsp;</p>

<p>* pRA-mETP-SpyTag_CM 10ul(concentrated)</p>

<p>pTrc-Spycatcher 200ng, 500ng, 100ng, 200ng, 500ng, 1000ng</p>

<p>&nbsp;binding test(Anti His) (15%)</p>

<p>* pRA-mETP-SpyTag_CM 10ul(concentrated)</p>

<p>pTrc-Spycatcher 200ng, 500ng, 100ng, 200ng, 500ng, 1000ng</p>

<p>binding test(Anti mETP(Tx621))(15%)</p>

<p>&nbsp;</p>

<p>Further study &amp; Prospect</p>

<p>&nbsp;</p>

<p>-Do protein interaction experiment in cell to see whether it is well connected in vitro</p>

<p>-</p>

<p>-</p>

<p>-Find the protein that is correlated with mETP through &lsquo;mass spectroscopy&rsquo; technique</p>

<p>&nbsp;</p>

<p>&nbsp;&nbsp;&nbsp; -&gt; Therefore, we can identify unknown &lsquo;protein&rsquo; and its gene and their location.</p>

<p>&nbsp;</p>

<p>-Applied to Genomics</p>

<p>&nbsp;&nbsp;&nbsp;</p>

<p>&nbsp;&nbsp;-&gt; Analyze how different, how overexpressed, how different of unknown &lsquo;protein&rsquo; gene between obese people to lean people by genome sequencing of certain region of unknown &lsquo;protein&rsquo; gene</p>

<p>&nbsp;</p>

<p>&nbsp;</p>

<p>Reference</p>

<p>&nbsp;</p>

<p>-&nbsp;&nbsp; Definition of Proteomics <a href="http://biolecture.org/index.php/Proteomics">http://</a><a href="http://biolecture.org/index.php/Proteomics">biolecture.org/index.php/Proteomics</a></p>

<p>-&nbsp;&nbsp; Definition of Omics <a href="http://biolecture.org/index.php/Omics">http</a><a href="http://biolecture.org/index.php/Omics">://</a><a href="http://biolecture.org/index.php/Omics">biolecture.org/index.php/Omics</a></p>

<p>-Bhak, J. (2016, 6 13). Openfree biolecture. Retrieved from Openfree biolecture: <u><a href="http://biolecture.org/index.php/SELF:_Self_evaluating_learning_framework">http://biolecture.org/index.php/SELF:_Self_evaluating_learning_framework</a></u></p>

<p>-Endotrophin triggers adipose tissue fibrosis and metabolic dysfunction. <u><a href="https://www.ncbi.nlm.nih.gov/pubmed/24647224">https://www.ncbi.nlm.nih.gov/pubmed/24647224</a></u></p>

<p>-Adipocyte-derived endotrophin promotes malignant tumor progression</p>

<p><u><a href="https://www.jci.org/articles/view/63930">https://www.jci.org/articles/view/63930</a></u></p>

<p>-Secrets of a covalent interaction for biomaterials and biotechnology: SpyTag and SpyCatcher.</p>

<p><u><a href="https://www.ncbi.nlm.nih.gov/pubmed/26517567">https://www.ncbi.nlm.nih.gov/pubmed/26517567</a></u></p>

<p>-Directed evolution of APEX2 for electron microscopy and proximity labeling.</p>

<p><u><a href="https://www.ncbi.nlm.nih.gov/pubmed/25419960">https://www.ncbi.nlm.nih.gov/pubmed/25419960</a></u></p>

<p>-From genomics to proteomics (Nature Review)</p>

<p><u><a href="http://www.nature.com/nature/journal/v422/n6928/full/nature01510.html">http://www.nature.com/nature/journal/v422/n6928/full/nature01510.html</a></u></p>

<p>-Innovation: Metabolomics: the apogee of the omics trilogy</p>

<p><u><a href="http://www.nature.com/nrm/journal/v13/n4/abs/nrm3314.html">http://www.nature.com/nrm/journal/v13/n4/abs/nrm3314.html</a></u></p>

<p>-Mass-spectrometric exploration of proteome structure and function</p>

<p><u><a href="http://www.nature.com/nature/journal/v537/n7620/abs/nature19949.html">http://www.nature.com/nature/journal/v537/n7620/abs/nature19949.html</a></u></p>

<p>&nbsp;</p>

<p>------------------------------------------------------------</p>

<p>[[20131571 조우빈]]</p>