imported>Galilei |
imported>조우빈 |
| Line 1: |
Line 1: |
| − | <p><strong>Galileo<font color="#000000"> Galilei</font></strong><font color="#000000"> (15 February 1564<sup id="cite_ref-birthdate_1-0" class="reference"><font size="2"><span>[</span>2<span>]</span></font></sup> – 8 January 1642)<sup id="cite_ref-McTutor_0-4" class="reference"><font size="2"><span>[</span>1<span>]</span></font></sup><sup id="cite_ref-2" class="reference"><font size="2"><span>[</span>3<span>]</span></font></sup> was an Italian physicist, mathematician, astronomer, and philosopher who played a major role in the Scientific Revolution. His achievements include improvements to the telescope and consequent astronomical observations, and support for Copernicanism. Galileo has been called the "father of modern observational astronomy,"<sup id="cite_ref-3" class="reference"><font size="2"><span>[</span>4<span>]</span></font></sup> the "father of modern physics,"<sup id="cite_ref-Einstein_4-0" class="reference"><font size="2"><span>[</span>5<span>]</span></font></sup> the "father of science,"<sup id="cite_ref-Einstein_4-1" class="reference"><font size="2"><span>[</span>5<span>]</span></font></sup> and "the Father of Modern Science."<sup id="cite_ref-finocchiaro2007_5-0" class="reference"><font size="2"><span>[</span>6<span>]</span></font></sup> Stephen Hawking says, "Galileo, perhaps more than any other single person, was responsible for the birth of modern science."<sup id="cite_ref-6" class="reference"><font size="2"><span>[</span>7<span>]</span></font></sup></font></p> | + | <p> </p> |
| − | <p><font color="#000000">The motion of uniformly accelerated objects, taught in nearly all high school and introductory college physics courses, was studied by Galileo as the subject of kinematics. His contributions to observational astronomy include the telescopic confirmation of the phases of Venus, the discovery of the four largest satellites of Jupiter (named the Galilean moons in his honour), and the observation and analysis of sunspots. Galileo also worked in applied science and technology, improving compass design.</font></p>
| |
| − | <p><font color="#000000">Galileo's championing of Copernicanism was controversial within his lifetime, when a large majority of philosophers and astronomers still subscribed (at least outwardly) to the geocentric view that the Earth is at the centre of the universe. After 1610, when he began supporting heliocentrism publicly, he met with bitter opposition from some philosophers and clerics, and two of the latter eventually denounced him to the Roman Inquisition early in 1615. Although he was cleared of any offence at that time, the Catholic Church nevertheless condemned heliocentrism as "false and contrary to Scripture" in February 1616,<sup id="cite_ref-contrary_to_scripture_7-0" class="reference"><font size="2"><span>[</span>8<span>]</span></font></sup> and Galileo was warned to abandon his support for it—which he promised to do. When he later defended his views in his most famous work, <em>Dialogue Concerning the Two Chief World Systems</em>, published in 1632, he was tried by the Inquisition, found "vehemently suspect of heresy," forced to recant, and spent the rest of his life under house arrest.</font></p>
| |
| | | | |
| − | <p><font color="#000000"></font></p> | + | <p><strong>Obese in Genomics</strong></p> |
| − | <h2><span class="mw-headline"><font color="#000000">Life</font></span></h2> | + | |
| − | <p><font color="#000000">Galileo was born in Pisa (then part of the Duchy of Florence), Italy, the first of six children of Vincenzo Galilei, a famous lutenist and music theorist, and Giulia Ammannati. Four of their six children survived infancy, and the youngest Michelangelo (or Michelagnolo) became a noted lutenist and composer.</font></p> | + | <p> </p> |
| − | <p><font color="#000000">Galileo's full name was Galileo di Vincenzo Bonaiuti de' Galilei. At the age of 8, his family moved to Florence, but he was left with Jacopo Borghini for two years.<sup id="cite_ref-McTutor_0-5" class="reference"><font size="2"><span>[</span>1<span>]</span></font></sup> He then was educated in the Camaldolese Monastery at Vallombrosa, 35 km southeast of Florence.<sup id="cite_ref-McTutor_0-6" class="reference"><font size="2"><span>[</span>1<span>]</span></font></sup> Although he seriously considered the priesthood as a young man, he enrolled for a medical degree at the University of Pisa at his father's urging. He did not complete this degree, but instead studied mathematics.<sup id="cite_ref-8" class="reference"><font size="2"><span>[</span>9<span>]</span></font></sup> In 1589, he was appointed to the chair of mathematics in Pisa. In 1591 his father died and he was entrusted with the care of his younger brother Michelagnolo. In 1592, he moved to the University of Padua, teaching geometry, mechanics, and astronomy until 1610.<sup id="cite_ref-9" class="reference"><font size="2"><span>[</span>10<span>]</span></font></sup> During this period Galileo made significant discoveries in both pure science (for example, kinematics of motion, and astronomy) and applied science (for example, strength of materials, improvement of the telescope). His multiple interests included the study of astrology, which in pre-modern disciplinary practice was seen as correlated to the studies of mathematics and astronomy.<sup id="cite_ref-10" class="reference"><font size="2"><span>[</span>11<span>]</span></font></sup></font></p> | + | |
| − | <p><font color="#000000">Although a genuinely pious Roman Catholic<sup id="cite_ref-11" class="reference"><font size="2"><span>[</span>12<span>]</span></font></sup>, Galileo fathered three children out of wedlock with Marina Gamba. They had two daughters, Virginia in 1600 and Livia in 1601, and one son, Vincenzo, in 1606. Because of their illegitimate birth, their father considered the girls unmarriageable. Their only worthy alternative was the religious life. Both girls were sent to the convent of San Matteo in Arcetri and remained there for the rest of their lives.<sup id="cite_ref-daughters_unmarriageable_12-0" class="reference"><font size="2"><span>[</span>13<span>]</span></font></sup> Virginia took the name Maria Celeste upon entering the convent. She died on 2 April 1634, and is buried with Galileo at the Basilica di Santa Croce di Firenze. Livia took the name Sister Arcangela and was ill for most of her life. Vincenzo was later legitimized and married Sestilia Bocchineri.<sup id="cite_ref-13" class="reference"><font size="2"><span>[</span>14<span>]</span></font></sup></font></p> | + | <p><strong>What is Obese?</strong></p> |
| − | <p><font color="#000000">In 1610 Galileo published an account of his telescopic observations of the moons of Jupiter, using this observation to argue in favour of the sun-centered, Copernican theory of the universe against the dominant earth-centered Ptolemaic and Aristotelian theories. The next year Galileo visited Rome in order to demonstrate his telescope to the influential philosophers and mathematicians of the Jesuit Collegio Romano, and to let them see with their own eyes the reality of the four moons of Jupiter.<sup id="cite_ref-14" class="reference"><font size="2"><span>[</span>15<span>]</span></font></sup> While in Rome he was also made a member of the Accademia dei Lincei.<sup id="cite_ref-15" class="reference"><font size="2"><span>[</span>16<span>]</span></font></sup></font></p> | + | |
| − | <p><font color="#000000">In 1612, opposition arose to the Sun-centered theory of the universe which Galileo supported. In 1614, from the pulpit of the Basilica of Santa Maria Novella, Father Tommaso Caccini (1574–1648) denounced Galileo's opinions on the motion of the Earth, judging them dangerous and close to heresy. Galileo went to Rome to defend himself against these accusations, but, in 1616, Cardinal Roberto Bellarmino personally handed Galileo an admonition enjoining him neither to advocate nor teach Copernican astronomy.<sup id="cite_ref-16" class="reference"><font size="2"><span>[</span>17<span>]</span></font></sup> During 1621 and 1622 Galileo wrote his first book, <em>The Assayer</em> (<em>Il Saggiatore</em>), which was approved and published in 1623. In 1630, he returned to Rome to apply for a license to print the <em>Dialogue Concerning the Two Chief World Systems</em>, published in Florence in 1632. In October of that year, however, he was ordered to appear before the Holy Office in Rome.</font></p>
| + | < div>- Obesity is a < a href=" https:// en.wikipedia.org/ wiki/ Medical_condition"> medical condition</ a> in which excess <a href=" https:// en. wikipedia. org/ wiki/ Body_fat"> body fat</ a> has accumulated to the extent that it may have a negative effect on health.</ div> |
| − | <p><font color="#000000">Following a papal trial in which he was found vehemently suspect of heresy, Galileo was placed under house arrest and his movements restricted by the Pope. From 1634 onward he stayed at his country house at Arcetri, outside of Florence. He went completely blind in 1638 and was suffering from a painful hernia and insomnia, so he was permitted to travel to Florence for medical advice. He continued to receive visitors until 1642, when, after suffering fever and heart palpitations, he died.<sup id="cite_ref-17" class="reference"><font size="2"><span>[</span>18<span>]</span></font></sup><sup id="cite_ref-18" class="reference"><font size="2"><span>[</span>19<span>]</span></font></sup></font></p>
| + | |
| − | <p><font color="#000000" size="2"></font></p>
| + | <div> </div> |
| − | <h2><span class="mw-headline"><font color="#000000">Scientific methods</font></span></h2> | + | |
| − | <p><font color="#000000">Galileo made original contributions to the science of motion through an innovative combination of experiment and mathematics.<sup id="cite_ref-19" class="reference"><font size="2"><span>[</span>20<span>]</span></font></sup> More typical of science at the time were the qualitative studies of William Gilbert, on magnetism and electricity. Galileo's father, Vincenzo Galilei, a lutenist and music theorist, had performed experiments establishing perhaps the oldest known non-linear relation in physics: for a stretched string, the pitch varies as the square root of the tension.<sup id="cite_ref-20" class="reference"><font size="2"><span>[</span>21<span>]</span></font></sup> These observations lay within the framework of the Pythagorean tradition of music, well-known to instrument makers, which included the fact that subdividing a string by a whole number produces a harmonious scale. Thus, a limited amount of mathematics had long related music and physical science, and young Galileo could see his own father's observations expand on that tradition.<sup id="cite_ref-21" class="reference"><font size="2"><span>[</span>22<span>]</span></font></sup></font></p> | + | < div> -People are generally considered obese when their <a href=" https:// en. wikipedia. org/ wiki/ Body_mass_index"> body mass index</ a> (BMI), a measurement obtained by dividing a person's weight by the square of the person's height, is over 30 < a href=" https:// en.wikipedia.org/ wiki/ Kilogram"> kg</ a>/< a href=" https://en. wikipedia. org/ wiki/ Square_metre"> m</ a><a href=" https:// en.wikipedia.org/ wiki/ Square_metre"> 2</ a> , with the range 25– 30 < a href=" https:// en.wikipedia.org/ wiki/ Kilogram"> kg</ a>/< a href="https:// en. wikipedia. org/wiki/ Square_metre"> m</ a><a href=" https:// en.wikipedia.org/ wiki/ Square_metre">2</ a> defined as < a href="https:// en.wikipedia.org/ wiki/ Overweight"> overweight</ a></ div> |
| − | <p><font color="#000000">Galileo is perhaps the first to clearly state that the laws of nature are mathematical. In <em>The Assayer</em> he wrote "Philosophy is written in this grand book, the universe ... It is written in the language of mathematics, and its characters are triangles, circles, and other geometric figures; ... ."<sup id="cite_ref-22" class="reference"><font size="2"><span>[</span>23<span>]</span></font></sup> His mathematical analyses are a further development of a tradition employed by late scholastic natural philosophers, which Galileo learned when he studied philosophy.<sup id="cite_ref-23" class="reference"><font size="2"><span>[</span>24<span>]</span></font></sup> Although he tried to remain loyal to the Catholic Church, his adherence to experimental results, and their most honest interpretation, led to a rejection of blind allegiance to authority, both philosophical and religious, in matters of science. In broader terms, this aided the separation of science from both philosophy and religion; a major development in human thought.</font></p>
| + | |
| − | <p><font color="#000000">By the standards of his time, Galileo was often willing to change his views in accordance with observation. Modern philosopher of science Paul Feyerabend also noted the supposedly improper aspects of Galileo's methodology, but he argued that Galileo's methods could be justified retroactively by their results. The bulk of Feyerabend's major work, <em>Against Method</em> (1975), was devoted to an analysis of Galileo, using his astronomical research as a case study to support Feyerabend's own anarchistic theory of scientific method. As he put it: 'Aristotelians ... demanded strong empirical support while the Galileans were content with far-reaching, unsupported and partially refuted theories. I do not criticize them for that; on the contrary, I favour Niels Bohr's "this is not crazy enough."'<sup id="cite_ref-24" class="reference"><font size="2"><span>[</span>25<span>]</span></font></sup> In order to perform his experiments, Galileo had to set up standards of length and time, so that measurements made on different days and in different laboratories could be compared in a reproducible fashion.</font></p>
| + | <div> </div> |
| − | <p><font color="#000000">Galileo showed a remarkably modern appreciation for the proper relationship between mathematics, theoretical physics, and experimental physics. He understood the parabola, both in terms of conic sections and in terms of the ordinate (y) varying as the square of the abscissa (x). Galilei further asserted that the parabola was the theoretically ideal trajectory of a uniformly accelerated projectile in the absence of friction and other disturbances. He conceded that there are limits to the validity of this theory, noting on theoretical grounds that a projectile trajectory of a size comparable to that of the Earth could not possibly be a parabola,<sup id="cite_ref-25" class="reference"><font size="2"><span>[</span>26<span>]</span></font></sup> but he nevertheless maintained that for distances up to the range of the artillery of his day, the deviation of a projectile's trajectory from a parabola would only be very slight.<sup id="cite_ref-26" class="reference"><font size="2"><span>[</span>27<span>]</span></font></sup> Thirdly, he recognized that his experimental data would never agree exactly with any theoretical or mathematical form, because of the imprecision of measurement, irreducible friction, and other factors.</font></p> | + | |
| − | <p><font color="#000000">According to Stephen Hawking, Galileo probably bears more of the responsibility for the birth of modern science than anybody else,<sup id="cite_ref-Hawking_galileo_27-0" class="reference"><font size="2"><span>[</span>28<span>]</span></font></sup> and Albert Einstein called him the father of modern science.<sup id="cite_ref-father_of_science_Einstein_28-0" class="reference"><font size="2"><span>[</span>29<span>]</span></font></sup></font></p>
| + | < div> -Obesity increases the likelihood of < a href=" https:// en.wikipedia.org/ wiki/ Obesity-associated_morbidity"> various diseases</ a>, particularly <a href=" https:// en.wikipedia.org/ wiki/ Cardiovascular_diseases"> heart disease</ a>, <a href=" https:// en.wikipedia.org/ wiki/ Diabetes_mellitus_type_2"> type 2 diabetes</ a> , < a href=" https:// en. wikipedia. org/ wiki/ Obstructive_sleep_apnea"> obstructive sleep apnea</ a> , certain types of <a href=" https:// en. wikipedia. org/ wiki/ Cancer"> cancer</ a>, and <a href="https: //en. wikipedia. org/ wiki/ Osteoarthritis"> osteoarthritis</ a> .</ div> |
| − | <p><font color="#000000" size="2"></font></p> | + | |
| − | <h2><span class="mw-headline"><font color="#000000">Astronomy</font></span></h2>
| + | <div> </div> |
| − | <p><font color="#000000"></font></p> | + | |
| − | <h3><span class="mw-headline"><font color="#000000">Contributions</font></span></h3>
| + | <div>-Obesity is most commonly caused by a combination of excessive <a href="https://en.wikipedia.org/wiki/Food_energy">food</a> intake, lack of physical activity, and <a href="https://en.wikipedia.org/wiki/Polygenic_inheritance">genetic susceptibility</a>.</div> |
| − | <div class="thumb tright">
| + | |
| − | <div style="WIDTH: 182px" class="thumbinner"><font color="#000000"><img class="thumbimage" alt="" width="180" height="276" src="http://upload.wikimedia.org/wikipedia/commons/thumb/8/87/Galileo.script.arp.600pix.jpg.jpg/180px-Galileo.script.arp.600pix.jpg.jpg" /> </font> | + | <div> </div> |
| − | <div class="thumbcaption">
| + | |
| − | <div class="magnify"><font color="#000000"><img alt="" width="15" height="11" src="/skins-1.5/common/images/magnify-clip.png" /></font></div> | + | <div> |
| − | <font color="#000000">It was on this page that Galileo first noted an observation of the moons of Jupiter. This observation upset the notion that all celestial bodies must revolve around the Earth. Galileo published a full description in <em>Sidereus Nuncius</em> in March 1610</font></div>
| + | <p> </p> |
| | + | |
| | + | <p><strong>Arrangement of basic terms in Genomics</strong></p> |
| | + | |
| | + | <p> </p> |
| | + | |
| | + | <p><strong>What is Genomics?</strong></p> |
| | </div> | | </div> |
| | + | |
| | + | <p>Genomics is the <a href="http://biopedia.org/index.php/Omics">omics</a> study of <a href="http://biopedia.org/index.php/Gene">genes</a> of individual organisms, populations, and <a href="http://biopedia.org/index.php/Species">species</a>.</p> |
| | + | |
| | + | <p>Paradigm of performing biological science that deviates from investigating single genes, their functions, and roles.</p> |
| | + | |
| | + | <p> </p> |
| | + | |
| | + | <p><strong>What is Omics?</strong></p> |
| | + | |
| | + | <p>General term for a broad discipline of science and engineering</p> |
| | + | |
| | + | <p>Analyzing the interactions of biological information objects in various <a href="http://omics.org/index.php?title=Omes&action=edit">omes</a> in biology</p> |
| | + | |
| | + | <p><strong>Main focus</strong></p> |
| | + | |
| | + | <div>1)mapping information objects such as genes and proteins</div> |
| | + | |
| | + | <div><strong><u>2)finding interaction relationships among the objects</u></strong></div> |
| | + | |
| | + | <div>3)engineering the networks and objects to understand and manipulate the regulatory mechanisms</div> |
| | + | |
| | + | <div> </div> |
| | + | |
| | + | <div> </div> |
| | + | |
| | + | <div><strong>What is Proteomics?</strong></div> |
| | + | |
| | + | <div> </div> |
| | + | |
| | + | <div> |
| | + | <p>Omics study of proteins, particularly their structures, sequences, and functions.</p> |
| | + | |
| | + | <p> (which proteins interact)</p> |
| | + | |
| | + | <p> </p> |
| | + | |
| | + | <p>The set of proteins produced by it during its life, and its genome is its set of genes.</p> |
| | + | |
| | + | <p> </p> |
| | + | |
| | + | <p>A proteome differs from cell to cell and constantly changes through its biochemical interactions with the genome and the environment.</p> |
| | + | |
| | + | <p>=> One organism has radically different protein expression in different parts of its body, different stages of its life cycle and different environmental conditions</p> |
| | + | |
| | + | <p>*There are far fewer protein-coding genes in the human genome than proteins in the human proteome (20,000 to 25,000 genes vs. > 500,000 proteins)</p> |
| | + | |
| | + | <p>=> Protein diversity is thought to be due to alternative splicing and post-translational modification of proteins</p> |
| | + | |
| | + | <p> </p> |
| | + | |
| | + | <p>New methods include protein microarrays, <u><strong>immunoaffinity chromatography followed by mass spectrometry(MALDI-TOF mass spectrometry),</strong> </u>and combinations of experimental methods such as phage display and computational methods.</p> |
| | + | |
| | + | <p> </p> |
| | + | |
| | + | <p><strong>What is Metabolome?</strong></p> |
| | + | |
| | + | <p> </p> |
| | + | |
| | + | <p>Interaction between an organism’s genome and its environment</p> |
| | + | |
| | + | <p> </p> |
| | + | |
| | + | <p>Complete set of <a href="https://en.wikipedia.org/wiki/Small_molecule">small-molecule</a> chemicals found within a biological sample.</p> |
| | + | |
| | + | <p> </p> |
| | + | |
| | + | <p>The <a href="https://en.wikipedia.org/wiki/Small_molecule">small molecule</a> chemicals found in a given metabolome may include both endogenous <a href="https://en.wikipedia.org/wiki/Metabolites">metabolites</a> that are naturally produced by an <a href="https://en.wikipedia.org/wiki/Organism">organism</a> as well as exogenous chemicals</p> |
| | + | |
| | + | <p> </p> |
| | + | |
| | + | <p><strong>The endogenous metabolome</strong></p> |
| | + | |
| | + | <p>-> primary metabolome</p> |
| | + | |
| | + | <p>-> Secondary metabolome</p> |
| | + | |
| | + | <p> </p> |
| | + | |
| | + | <p><a href="https://en.wikipedia.org/wiki/Primary_metabolite">* primary metabolite</a> is directly involved in the normal growth, development, and reproduction.</p> |
| | + | |
| | + | <p><a href="https://en.wikipedia.org/wiki/Secondary_metabolite">*secondary metabolite</a> is not directly involved in those processes, but usually has important ecological function(ex: <a href="https://en.wikipedia.org/wiki/Pigments">pigments</a>, <a href="https://en.wikipedia.org/wiki/Antibiotics">antibiotics</a> or waste products derived from partially metabolized <a href="https://en.wikipedia.org/wiki/Xenobiotics">xenobiotics</a>)</p> |
| | + | |
| | + | <p><a href="https://en.wikipedia.org/wiki/NMR_spectroscopy">Use NMR spectroscopy</a> and <a href="https://en.wikipedia.org/wiki/Mass_spectrometry">mass spectrometry</a>.</p> |
| | + | |
| | + | <p> </p> |
| | + | |
| | + | <p> </p> |
| | + | |
| | + | <p><strong>The Human Metabolome Database</strong></p> |
| | + | |
| | + | <p> </p> |
| | + | |
| | + | <p>Contain detailed data on more than 40,000 metabolites that have already been identified or are likely to be found in the human body</p> |
| | + | |
| | + | <p> </p> |
| | + | |
| | + | <div>1)Chemical information</div> |
| | + | |
| | + | <p>- includes >40,000 metabolite structures with detailed descriptions, extensive chemical classifications, synthesis information and observed/calculated chemical properties</p> |
| | + | |
| | + | <div> </div> |
| | + | |
| | + | <div>2)Clinical information</div> |
| | + | |
| | + | <p>- includes data on >10,000 <a href="https://en.wikipedia.org/wiki/Metabolite">metabolite</a>-<a href="https://en.wikipedia.org/wiki/Biofluid">biofluid</a> concentrations, metabolite concentration information on more than 600 different human diseases and pathway data for more than 200 different inborn errors of metabolism.</p> |
| | + | |
| | + | <div> </div> |
| | + | |
| | + | <div> </div> |
| | + | |
| | + | <div>3)Biochemical information.</div> |
| | + | |
| | + | <p>- includes nearly 6000 protein (and DNA) sequences and more than 5000 biochemical reactions that are linked to these metabolite entries</p> |
| | </div> | | </div> |
| − | <div class="thumb tright">
| + | |
| − | <div style="WIDTH: 182px" class="thumbinner"><font color="#000000"><img class="thumbimage" alt="" width="180" height="135" src="http://upload.wikimedia.org/wikipedia/commons/thumb/d/d1/Phases-of-Venus.svg/180px-Phases-of-Venus.svg.png" /> </font>
| + | <p> </p> |
| − | <div class="thumbcaption">
| + | |
| − | <div class="magnify"><font color="#000000"><img alt="" width="15" height="11" src="/skins-1.5/common/images/magnify-clip.png" /></font></div>
| + | <p>---------------------------------------------</p> |
| − | <font color="#000000">The phases of Venus, observed by Galileo in 1610</font></div>
| + | |
| − | </div>
| + | <p>Obese</p> |
| − | </div>
| + | |
| − | <p><font color="#000000">Based only on uncertain descriptions of the first practical telescope, invented by Hans Lippershey in the Netherlands in 1608, Galileo, in the following year, made a telescope with about 3x magnification. He later made others with up to about 30x magnification.<sup id="cite_ref-29" class="reference"><font size="2"><span>[</span>30<span>]</span></font></sup> With this improved device he could see magnified, upright images on the earth – it was what is now known as a terrestrial telescope, or spyglass. He could also use it to observe the sky; for a time he was one of those who could construct telescopes good enough for that purpose. On 25 August 1609, he demonstrated his first telescope to Venetian lawmakers. His telescopes were a profitable sideline. He could sell them
| + | <p> </p> |
| | + | |
| | + | <p>-> Mainly Influenced by External effects!</p> |
| | + | |
| | + | <p>-> The Disease that can be cured!</p> |
| | + | |
| | + | <p>-> Obese parents usually have obese children!</p> |
| | + | |
| | + | <p> </p> |
| | + | |
| | + | <p><strong><u>Therefore, Focus more on protemoics, Metabolome!</u></strong></p> |
| | + | |
| | + | <p> -----------------------------------------------------------------------</p> |
| | + | |
| | + | <p><strong><span style=" |
Obese in Genomics
What is Obese?
-Obesity is a
medical condition in which excess
body fat has accumulated to the extent that it may have a negative effect on health.
-People are generally considered obese when their
body mass index (BMI), a measurement obtained by dividing a person's weight by the square of the person's height, is over 30
kg/
m2 , with the range 25–30
kg/
m2 defined as
overweight
-Obesity is most commonly caused by a combination of excessive
food intake, lack of physical activity, and
genetic susceptibility.
Arrangement of basic terms in Genomics
What is Genomics?
Genomics is the omics study of genes of individual organisms, populations, and species.
Paradigm of performing biological science that deviates from investigating single genes, their functions, and roles.
What is Omics?
General term for a broad discipline of science and engineering
Analyzing the interactions of biological information objects in various omes in biology
Main focus
1)mapping information objects such as genes and proteins
2)finding interaction relationships among the objects
3)engineering the networks and objects to understand and manipulate the regulatory mechanisms
What is Proteomics?
Omics study of proteins, particularly their structures, sequences, and functions.
(which proteins interact)
The set of proteins produced by it during its life, and its genome is its set of genes.
A proteome differs from cell to cell and constantly changes through its biochemical interactions with the genome and the environment.
=> One organism has radically different protein expression in different parts of its body, different stages of its life cycle and different environmental conditions
*There are far fewer protein-coding genes in the human genome than proteins in the human proteome (20,000 to 25,000 genes vs. > 500,000 proteins)
=> Protein diversity is thought to be due to alternative splicing and post-translational modification of proteins
New methods include protein microarrays, immunoaffinity chromatography followed by mass spectrometry(MALDI-TOF mass spectrometry), and combinations of experimental methods such as phage display and computational methods.
What is Metabolome?
Interaction between an organism’s genome and its environment
Complete set of small-molecule chemicals found within a biological sample.
The small molecule chemicals found in a given metabolome may include both endogenous metabolites that are naturally produced by an organism as well as exogenous chemicals
The endogenous metabolome
-> primary metabolome
-> Secondary metabolome
* primary metabolite is directly involved in the normal growth, development, and reproduction.
*secondary metabolite is not directly involved in those processes, but usually has important ecological function(ex: pigments, antibiotics or waste products derived from partially metabolized xenobiotics)
Use NMR spectroscopy and mass spectrometry.
The Human Metabolome Database
Contain detailed data on more than 40,000 metabolites that have already been identified or are likely to be found in the human body
1)Chemical information
- includes >40,000 metabolite structures with detailed descriptions, extensive chemical classifications, synthesis information and observed/calculated chemical properties
2)Clinical information
- includes data on >10,000 metabolite-biofluid concentrations, metabolite concentration information on more than 600 different human diseases and pathway data for more than 200 different inborn errors of metabolism.
3)Biochemical information.
- includes nearly 6000 protein (and DNA) sequences and more than 5000 biochemical reactions that are linked to these metabolite entries
---------------------------------------------
Obese
-> Mainly Influenced by External effects!
-> The Disease that can be cured!
-> Obese parents usually have obese children!
Therefore, Focus more on protemoics, Metabolome!
-----------------------------------------------------------------------
Adipose tissue
-> Adipokine
-> Adipose tissue secreted multiple mediator
-> Passed through either endocrine or paracrine
Ex: Hormone: leptin, adiponectin
-> Adiponectin
-> Adipocyte-secreted adipokine
-> Increase lipid oxidation& anti-inflammatory, insulin-sensitizing, angiogenic action
=> Anti obesity & Antidiabetic, Decrease insulin resistance
400px
400px
-> Illustration of the major physiological and metabolic
processes with which adipose tissue is involved through the secretion
of various adipokines from adipocytes. The interactions may be
autocrine, paracrine, or endocrine.
<Searching Scientific Reports>
400px
400px
<What is Col6?>
- COL6 = Collagen type 6
- Abundant constituent of white adipose tissue (WAT)
- COL6 levels positively correlate with hyperglycaemia and insulin resistance
- Composed of three distinct a chains, a1, a2 and a3.(COL6 trimeric building block) and are subsequently secreted into the ECM
<What is a3 Chain?>
-> longest of the three chains
- contains an unusually long N terminus and a globular C5 domain at the C-terminus
-> C-terminal portion of the a3 subunit is cleaved off during the post-translational processing of COL6 fibrils(COL6a3, Endotrophin)
<What is Endotrophin?>
- Adipokine with potent tumour-promoting effects
- Plays a pivotal role in shaping a metabolically unfavorable microenvironment in adipose tissue during consumption of a high-fat diet (HFD)
- Powerful co-stimulator of pathologically relevant pathways within the ‘unhealthy’ adipose tissue milieu, triggering fibrosis and inflammation and ultimately leading to enhanced insulin resistance& metabolic dysfunction.
- Exerts a major influence in adipose tissue
- Endotrophin within the tumor microenvironment serves as a major mediator of COL6-stimulated mammary tumor growth and subsequent chemo resistance
- Stimulates fibrosis, activates endothelial cell migration and promotes macrophage infiltration into growing solid tumors.
=> elevated mammary tumor expansion and more pronounced metastatic growth
400px
---------------------------------------------------------
Problem!
-> Don’t know the mechanism of how ETP works.
What I’m going to do!
-> Find the Receptor according to the New method of Protemoics.
-> Find the interaction, relationship and mechanisms how they act.(Study of Omics)
-> Omics could be applied to genomics perspective!
mETP(204bp, 16.43kda)
ACAGAACCATTGTTTCTCACTAAAACAGATATATGTAAGCTGTCCAGAGATGCTGGGACTT
GTGTGGACTTCAAGTTACTATGGCACTATGACCTAGAGAGCAAAAGTTGCAAGAGATTCTG
GTATGGAGGTTGTGGAGGCAACGAGAACAGATTCCACTCCCAGGAAGAATGTGAAAAGATGTGTAGTCCTGAGTTAACAGTT
SpyTag(39bp, 16.43kda)
GCCCACATCGTGATGGTGGACGCCTACAAGCCGACGAAG
pRL(90bp, 7.48kda)
ATGGACAGCAAAGGTTCGTCGCAGAAAGGGTCCCGCCTGCTCCTGCTGCTGGTGGTGTCAAATCTACTCTTGTGCCAGGGTGTGGTCTCC
(1)
600px
pRA-GFP-EcoR1-pRL-unknown-mETP-SpyTag-Stop
-> How to make this cloning?
(1)By Using pRL-EcoR1 forward primer, mETP-SpyTag-Stop-Xho1 primer, make pRL-EcoR1-mETP-SpyTag-Stop-Xho1 by Ex-Tag PCR
500px
(2) Insert template gained from (1) in T-Vector to check whether it is really pRL-EcoR1-mETP-SpyTag-Stop-Xho1 or not.
(3) Use EcoR1, Xho1 Digestion enzyme to double digest T vector
(4) Double Digest pRA GFP vector(empty vector) and purify it.
(5) ligate (3), (4) product
-> Detailed on Each Steps
(1) Ex-Tag PCR process
->Template(pRA-GFP, 20ng): 1ul
->Primer: 1,1ul
->dNTP(10nM): 1ul
->10X Ex-Tag Buffer: 2.5ul
-> Ex-Tag polymerase: 1ul
-> D.W: 17.5ul
----------------------------------------
Total: 25ul
PCR
->Temperature Gradient : 54,56,58
->98 celsius : 2min
->98 celsius : 10sec
->57 celsius : 30sec
->72 celsius : 30sec(insert 300bp)
->72 celsius : 5min
X35
400px
-> Can see the insert(300bp) in both 54,56,58 temperature gradient!
(2)
<T vector ligation>
Insert DNA mass: 8.607ng(3:1)
2X Rapid ligation: 5ul
T vector: 0.5ul(25ng)
PCR product: 1ul(8.7ng)
D.W: 2.5ul
T4 DNA Ligase: 1ul
----------------------------
Total: 10ul
RT 1 hour incubation
Then, Transformation
<Colony PCR>
-> Check whether insert base pairs is inserted in T vector well
T.D.W : 14.9
10X Buffer : 2
M13 primer Forward: 0.5
M13 primer Reverse: 0.5
2.5mM dNTP: 1.6
XL-Taq polymerase: 0.5
---------------------------------
Can check on 3,5 well(T vector 200bp+ 346bp = 500~600bp)
(3)
------------------------------------------------------------
20131571 조우빈
