JaeYun Hyun 20121583

Essay 6 - About the Blast and BLAT.

In bioinformatics, BLAST for Basic Local Alignment Search Tool is an algorithm for comparing primary biological sequence information, such as the amino-acid sequences of proteins or the nucleotides of DNA sequences. A BLAST search enables a researcher to compare a query sequence with a library or database of sequences, and identify library sequences that resemble the query sequence above a certain threshold.

I want to write about the BLAT (BLAST-like alignment tool) is a pairwise sequence alignment algorithm that was developed by Jim Kent at the University of California Santa Cruz (UCSC) in the early 2000s to assist in the assembly and annotation of the human genome. It was designed primarily to decrease the time needed to align millions of mouse genomic reads and expressed sequence tags against the human genome sequence. The alignment tools of the time were not capable of performing these operations in a manner that would allow a regular update of the human genome assembly. Compared to pre-existing tools, BLAT was ~500 times faster with performing mRNA/DNA alignments and ~50 times faster with protein/protein alignments.

BLAT is one of multiple algorithms developed for the analysis and comparison of biological sequences such as DNA, RNA and proteins, with a primary goal of inferring homology in order to discover biological function of genomic sequences. It is not guaranteed to find the mathematically optimal alignment between two sequences like the classic Needleman-Wunsch and Smith-Waterman dynamic programming algorithms do; rather, it first attempts to rapidly detect short sequences which are more likely to be homologous, and then it aligns and further extends the homologous regions. It is similar to the heuristic BLAST family of algorithms, but each tool has tried to deal with the problem of aligning biological sequences in a timely and efficient manner by attempting different algorithmic techniques.

If I want to find the zebrafish apex1 gene's gRNA target site,

we need forward primer and reverse primer and target sequence. 

zebrafish apex1 gene is on the chr 4, and target sequence is  GGCTGCCCGGCCGTCCTTAC

Forward primers sequence is 

AAAGAGTTTGCATCCTCACAG

Reverse primer sequence is 

CAAGTCCGTTCTTTTTGACC

Then visit http://genome.ucsc.edu/cgi-bin/hgBlat

 

Like this way, we can find the zebrafish's apex1 gene gRNA target site and which exon was targeted. 

 

 

Reference

1. https://en.wikipedia.org/wiki/BLAST

2. https://en.wikipedia.org/wiki/BLAT_(bioinformatics)

3. http://genome.ucsc.edu/cgi-bin/hgBlat

4.  Kent, W James (2002). "BLAT--the BLAST-like alignment tool". Genome Research. 12 (4): 656–664. doi:10.1101/gr.229202. PMC 187518. PMID 11932250.

5. Altschul, SF; Gish, W; Miller, W; Myers, EW; Lipman, DJ (1990). "Basic local alignment search tool.". Journal of Molecular Biology. 215 (3): 403–10. doi:10.1016/S0022-2836(05)80360-2. PMID 2231712.