Open main menu

Biolecture.org β

Changes

Scientific Experiment

12,309 bytes added, 16:23, 4 November 2016
no edit summary
<p>&nbsp;</p> <p><strong>Obese in Genomics</strong></p> <p>&nbsp;</p> <p><strong>What is Obese?</strong></p> <div>-Obesity is a <a href="httphttps://wwwen.iscbwikipedia.org/wiki/Medical_condition">httpmedical condition</a> in which excess <a href="https://wwwen.iscbwikipedia.org/wiki/Body_fat">body fat</a>has accumulated to the extent that it may have a negative effect on health.<br /div<div>&nbsp;<br /div> <h1div>About ISCB-People are generally considered obese when their <a href="https://h1en.wikipedia.org/wiki/Body_mass_index">body mass index<p/a>The International Society for Computational Biology (ISCBBMI) serves , a measurement obtained by dividing a person&#39;s weight by the square of the person&#39;s height, is over 2500 members from nearly 70 countries around 30&nbsp;<a href="https://en.wikipedia.org/wiki/Kilogram">kg</a>/<a href="https://en.wikipedia.org/wiki/Square_metre">m</a><a href="https://en.wikipedia.org/wiki/Square_metre">2</a> , with the range 25&ndash;30&nbsp;<a href="https://en.wikipedia.org/wiki/Kilogram">kg</a>/<a href="https://en.wikipedia.org/wiki/Square_metre">m</a><a href="https://en.wikipedia.org/wiki/Square_metre">2</a> defined as <a href="https://en.wikipedia.org/wiki/Overweight">overweight</a></div> <div>&nbsp;</div> <div>-Obesity increases the world likelihood of <a href="https://en.wikipedia.org/wiki/Obesity-associated_morbidity">various diseases</a>, particularly <a href="https://en.wikipedia.org/wiki/Cardiovascular_diseases">heart disease</a>, <a href="https://en.wikipedia.org/wiki/Diabetes_mellitus_type_2">type 2 diabetes</a>, <a href="https://en.wikipedia.org/wiki/Obstructive_sleep_apnea">obstructive sleep apnea</a>, certain types of <a href="https://en.wikipedia.org/wiki/Cancer">cancer</a>, and <a href="https://en.wikipedia.org/wiki/Osteoarthritis">osteoarthritis</a>.</div> <div>&nbsp;</div> <div>-Obesity is most commonly caused by addressing scientific policiesa combination of excessive <a href="https://en.wikipedia.org/wiki/Food_energy">food</a> intake, providing access to high quality publicationslack of physical activity, and <a href="https://en.wikipedia.org/wiki/Polygenic_inheritance">genetic susceptibility</a>.</div> <div>&nbsp;</div> <div><p>&nbsp;</p> <p><strong>Arrangement of basic terms&nbsp;in Genomics</strong></p> <p>&nbsp;</p> <p><strong>What is Genomics?</strong></p></div> <p>Genomics is the <a href="http://biopedia.org/index.php/Omics">omics</a> study of <a href="http://biopedia.org/index.php/Gene">genes</a> of individual organisms, organizing meetings&nbsp;populations, and serving as <a href="http://biopedia.org/index.php/Species">species</a portal to information about training>.</p> <p>Paradigm of performing biological science that deviates from&nbsp;investigating single genes, educationtheir functions, employment and news from related fieldsroles.</p> <p>&nbsp;</p> <p><strong>What is Omics?</strong></p> <p>General term for a broad discipline of science and engineering</p> <p>Analyzing the interactions of biological information objects in various&nbsp;<a href="http://omics.org/index.php?title=Omes&amp;action=edit">omes</a> in biology</p> <p><strong>Main focus</strong></p> <div>1)mapping information objects such as genes and proteins</div> <div><strong><u>2)finding interaction relationships among the objects</u></strong></div> <div>3)engineering the networks and objects to understand and manipulate the regulatory mechanisms</div> <div>&nbsp;</div> <div>&nbsp;</div> <div><strong>What is Proteomics?</strong></div> <div>&nbsp; ISCB hosts annual meetings</div> <div><p>Omics study of&nbsp;proteins, including ISMBparticularly their structures, the world's longest running sequences,&nbsp;and largest bioinformatics conference functions.</p> <p>&nbsp;&nbsp; (held jointly with ECCB every other year in Europewhich proteins interact)</p> <p>&nbsp;</p> <p>The set of proteins produced by it during its life, affiliates and its genome is its set of genes.</p> <p>&nbsp;</p> <p>A proteome differs from cell to cell and constantly changes through its biochemical interactions with several other significant meetings the genome and the environment.</p> <p>=&gt; One organism has radically different protein expression in different parts of our scienceits body, has two official journals different stages of its life cycle and different environmental conditions</p> <p>*There are far fewer protein-coding genes in the highest impact factors human genome than proteins in the Mathematical human proteome (20,000 to 25,000 genes vs. &ampgt; 500,000 proteins)</p> <p>=&gt; Protein diversity is thought to be due to alternative splicing and post-translational modification of proteins</p> <p>&nbsp; Computational Biology category</p> <p>New methods include protein microarrays, <u><strong>immunoaffinity chromatography followed by mass spectrometry(MALDI-TOF mass spectrometry),</strong> </u>and combinations of experimental methods such as phage display and has affiliations computational methods.</p> <p>&nbsp;</p> <p><strong>What is Metabolome?</strong></p> <p>&nbsp;</p> <p>Interaction between an organism&rsquo;s genome and its environment</p> <p>&nbsp;</p> <p>Complete set of <a href="https://en.wikipedia.org/wiki/Small_molecule">small-molecule</a> chemicals found within a biological sample.</p> <p>&nbsp;</p> <p>The <a href="https://en.wikipedia.org/wiki/Small_molecule">small molecule</a> chemicals found in place with several other publications for the benefit of our membersa given metabolome may include both endogenous <a href="https://en.wikipedia.org/wiki/Metabolites">metabolites</a> that are naturally produced by an <a href="https://en.wikipedia.org/wiki/Organism">organism<br /a> as well as exogenous chemicals</p<p>&nbsp;<br /p>ISCB <p><strong>The endogenous metabolome</strong></p> <p>-&gt; primary metabolome</p> <p>-&gt; Secondary metabolome</p> <p>&nbsp;</p> <p><a href="https://en.wikipedia.org/wiki/Primary_metabolite">* primary metabolite</a> is incorporated directly involved in the United States as normal growth, development, and reproduction.</p> <p><a href="https://en.wikipedia.org/wiki/Secondary_metabolite">*secondary metabolite</a 501> is not directly involved in those processes, but usually has important ecological function(cex: <a href="https://en.wikipedia.org/wiki/Pigments">pigments</a>, <a href="https://en.wikipedia.org/wiki/Antibiotics">antibiotics</a> or waste products derived from partially metabolized <a href="https://en.wikipedia.org/wiki/Xenobiotics">xenobiotics</a>)</p> <p><a href="https://en.wikipedia.org/wiki/NMR_spectroscopy">Use NMR spectroscopy</a> and <a href="https://en.wikipedia.org/wiki/Mass_spectrometry">mass spectrometry</a>.</p> <p>&nbsp;</p> <p>&nbsp;</p> <p><strong>The Human Metabolome Database</strong></p> <p>&nbsp;</p> <p>Contain detailed data on more than 40,000 metabolites that have already been identified or are likely to be found in the human body</p> <p>&nbsp;</p> <div>1)Chemical information</div> <p>- includes &gt;40,000 metabolite structures with detailed descriptions, extensive chemical classifications, synthesis information and observed/calculated chemical properties</p> <div>&nbsp;</div> <div>2)Clinical information</div> <p>- includes data on &gt;10,000 <a href="https://en.wikipedia.org/wiki/Metabolite">metabolite</a>-<a href="https://en.wikipedia.org/wiki/Biofluid">biofluid</a> concentrations, metabolite concentration information on more than 600 different human diseases and pathway data for more than 200 different inborn errors of metabolism.</p> <div>&nbsp;</div> <div>&nbsp;</div> <div>3)Biochemical information.</div> <p>- includes nearly 6000 protein (and DNA) sequences and more than 5000 biochemical reactions that are linked to these metabolite entries</p></div> <p>&nbsp;</p> <p>---------------------------------------------</p> <p>Obese</p> <p>&nbsp;</p> <p>-&gt; Mainly Influenced by External effects!</p> <p>-&gt; The Disease that can be cured!</p> <p>-&gt; Obese parents usually have obese children!</p> <p>&nbsp;</p> <p><strong><u>Therefore, Focus more on protemoics, Metabolome!</u></strong></p> <p>&nbsp;-----------------------------------------------------------------------</p> <p><strong><span style="font-size:14px">Adipose tissue</span></strong></p> <p>&nbsp;</p> <p><strong>-&gt; Adipokine </strong></p> <p>&nbsp;&nbsp; -&gt; <span style="font-size:12px"><span style="color:black; font-family:맑은 고딕">Adipose tissue secreted multiple mediator</span></span></p> <p><span style="font-size:12px"><span style="color:black; font-family:맑은 고딕">&nbsp;&nbsp;&nbsp;</span></span>-&gt; Passed through either endocrine or paracrine</p> <p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; Ex: Hormone: leptin, adiponectin</p> <p>&nbsp;</p> <p><strong>-&gt; Adiponectin</strong></p> <p><strong>&nbsp;&nbsp;&nbsp; -&gt; </strong>Adipocyte-secreted adipokine</p> <p>&nbsp;&nbsp;&nbsp; -&gt; Increase lipid oxidation&amp; anti-inflammatory, insulin-sensitizing,&nbsp; angiogenic action</p> <p>&nbsp;&nbsp;&nbsp; <strong>=&gt; Anti obesity &amp; Antidiabetic, Decrease insulin resistance&nbsp;</strong></p> <p>&nbsp;[[File:1.png|400px]]</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>&nbsp;[[File:2.gif|400px]]</p> <p>-&gt; Illustration of the major physiological and metabolic</p> <p>processes with which adipose tissue is involved through the secretion</p> <p>of various adipokines from adipocytes. The interactions may be</p> <p>autocrine, paracrine, or endocrine.</p> <p>&nbsp;</p> <p><span style="font-size:16px"><strong>&lt;Searching Scientific Reports&gt;</strong></span></p> <p>&nbsp;[[File:3.png|400px]]</p> <p>&nbsp;[[File:4.png|400px]]</p> <p>&nbsp;</p> <p><strong><span style="font-size:16px">&lt;What is Col6?&gt;</span></strong></p> <p>- COL6 = Collagen type 6</p> <p>- Abundant constituent of white adipose tissue (WAT) non</p> <p>- COL6 levels positively correlate with hyperglycaemia and insulin resistance</p> <p>-profit corporationComposed of three distinct a chains, a1, a2 and registered in a3.(COL6 trimeric building block) and are subsequently secreted into the state ECM</p> <p>&nbsp;</p> <p><strong><span style="font-size:16px">&lt;What is a3 Chain?&gt;</span></strong></p> <p>-&gt; longest of California as the three chains</p> <p>- contains an unusually long N terminus and a Charitable Trust. Now hosted globular C5 domain at the San Diego Supercomputer Center at University C-terminus</p> <p>&nbsp;</p> <p>-&gt; C-terminal portion of the a3 subunit is cleaved off during the post-translational processing of CaliforniaCOL6 fibrils(COL6a3, San Diego, the Society was officially formed Endotrophin)</p> <p>&nbsp;</p> <p><strong><span style="font-size:16px">&lt;What is Endotrophin?&gt;</span></strong></p> <p>- Adipokine with potent tumour-promoting effects</p> <p>- Plays a pivotal role in shaping a metabolically unfavorable microenvironment in 1997 as an outgrowth adipose tissue during consumption of the International Conference on Intelligent Systems for Molecular Biology a high-fat diet (ISMBHFD)</p> <p>- Powerful co-stimulator of pathologically relevant pathways within the &lsquo;unhealthy&rsquo; adipose tissue milieu, triggering fibrosis and inflammation and ultimately leading to enhanced insulin resistance&amp; metabolic dysfunction. From humble beginnings</p> <p>- Exerts a major influence in adipose tissue</p> <p>- Endotrophin within the tumor microenvironment serves as a major mediator of COL6-stimulated mammary tumor growth and subsequent chemo resistance</p> <p>- Stimulates fibrosis, both ISCB's membership activates endothelial cell migration and promotes macrophage infiltration into growing solid tumors.</p> <p>=&gt; elevated mammary tumor expansion and ISMB's annual attendance have kept pace with the overall more pronounced metastatic growth experienced in </p> <p>&nbsp;[[File:5.png|400px]]</p> <p>---------------------------------------------------------</p> <p><u><strong><span style="font-size:18px">Problem!</span></strong></u></p> <p>&nbsp;</p> <p><strong>-&gt; Don&rsquo;t know the field mechanism of bioinformaticshow ETP works.</strong></computational biology.p> <p>&nbsp;</p> <p><br u><strong><span style="font-size:16px">What I&rsquo;m going to do!</span></strong></u></p> For <p>&nbsp;</p> <div><strong>-&gt; Find the complete story from conception Receptor according to present day please visit the History linkNew method of Protemoics. Additional links provide copies of documents that detail </strong></div> <div><strong>-&gt; Find the legal structure interaction, relationship and mechanisms how they act.(Study of ISCBOmics)</strong></div> <div><u><strong>&nbsp;-&gt; Omics could be applied to genomics perspective!</strong></u></div> <p>&nbsp;</p> <p>&nbsp;</p> <p>mETP(204bp, which may prove interesting 16.43kda)</p> <p>ACAGAACCATTGTTTCTCACTAAAACAGATATATGTAAGCTGTCCAGAGATGCTGGGACTT</p> <p>GTGTGGACTTCAAGTTACTATGGCACTATGACCTAGAGAGCAAAAGTTGCAAGAGATTCTG</p> <p>GTATGGAGGTTGTGGAGGCAACGAGAACAGATTCCACTCCCAGGAAGAATGTGAAAAGATGTGTAGTCCTGAGTTAACAGTT</p> <p>&nbsp;</p> <p>SpyTag(39bp, 16.43kda)</p> <p>GCCCACATCGTGATGGTGGACGCCTACAAGCCGACGAAG</p> <p>&nbsp;</p> <p>pRL(90bp, 7.48kda)</p> <p>ATGGACAGCAAAGGTTCGTCGCAGAAAGGGTCCCGCCTGCTCCTGCTGCTGGTGGTGTCAAATCTACTCTTGTGCCAGGGTGTGGTCTCC</p> <p>&nbsp;</p> <p>(1)</p> <p>&nbsp;[[File:12.png|600px]]</p> <p>&nbsp;pRA-GFP-EcoR1-pRL-unknown-mETP-SpyTag-Stop</p> <p>&nbsp;</p> <p>-&gt;<strong> How to our current and prospective membersmake this cloning?</strong></p> <p>(1)By Using pRL-EcoR1 forward primer, mETP-SpyTag-Stop-Xho1 primer, as well as be of some use make pRL-EcoR1-mETP-SpyTag-Stop-Xho1 by Ex-Tag PCR</p> <p>[[File:13.png|500px]]</p> <p>(2) Insert template gained from (1) in T-Vector to regional groups around the world wanting to form national check whether it is really pRL-EcoR1-mETP-SpyTag-Stop-Xho1&nbsp;or regional societies and not knowing how .</p> <p>(3) Use EcoR1, Xho1 Digestion enzyme to begindouble digest T vector</p> <p>(4) Double Digest pRA GFP vector(empty vector) and purify it.</p> <p>(5) ligate (3), (4) product</p> <p>&nbsp;</p> <p><strong>-&gt; Detailed on Each Steps</strong></p> <p>(1) Ex-Tag PCR process</p> <p>&nbsp;</p> <p>-&gt;Template(pRA-GFP, 20ng): 1ul</p> <p>-&gt;Primer: 1,1ul</p> <p>-&gt;dNTP(10nM): 1ul</p> <p>-&gt;10X Ex-Tag Buffer: 2. And finally5ul</p> <p>-&gt; Ex-Tag polymerase: 1ul</p> <p>-&gt; D.W: 17.5ul</p> <p>----------------------------------------</p> <p>Total: 25ul</p> <p>&nbsp;</p> <p>PCR</p> <p>-&gt;Temperature Gradient : 54,56, activities over 58</p> <p>-&gt;98 celsius : 2min</p> <p>-&gt;98 celsius : 10sec</p> <p>-&gt;57 celsius : 30sec</p> <p>-&gt;72 celsius&nbsp;: 30sec(insert 300bp)</p> <p>-&gt;72 celsius : 5min</p> <p>X35</p> <p>&nbsp;[[File:14.png|400px]]</p> <p>-&gt; Can see the years are documented insert(300bp) in the Newsletter Archivesboth 54,56,58 temperature gradient!</p> <p>&nbsp;</p> <p>&nbsp;(2)</p> <p>&lt;T vector ligation&gt;</p> <p>Insert DNA mass: 8.607ng(3:1)</p> <p>2X Rapid ligation: 5ul</p> <p>T vector: 0.5ul(25ng)</p> <p>PCR product: 1ul(8.7ng)</p> <p>D.W: 2. We encourage you to peruse all of these links for a perspective on where we've been and where you might help lead us 5ul</p> <p>T4 DNA Ligase: 1ul</p> <p>----------------------------</p> <p>Total: 10ul</p> <p>RT 1 hour incubation</p> <p>Then, Transformation</p> <p>&nbsp;</p> <p>&lt;Colony PCR&gt;</p> <p>-&gt; Check whether insert base pairs is inserted in the years aheadT vector well</p> <p>T.D.W : 14.9</p> <p>10X Buffer : 2</p> <p>M13 primer Forward: 0.5</p> <p>M13 primer Reverse: 0.5</p> <p>2.5mM dNTP: 1.6</p> <p>XL-Taq polymerase: 0.5</p> <p>&nbsp;---------------------------------</p> <p>[[File:15.jpg|400px]]</p> <p>Can check on 3,5 well(T vector 200bp+ 346bp = 500~600bp)</p> <p>&nbsp;</p> <p>&nbsp;(3)</p> <p>&nbsp;</p> <p>&nbsp;</p> <p>------------------------------------------------------------</p> <p>[[20131571 조우빈]]</p>
Anonymous user