Open main menu

Biolecture.org β

Changes

Scientific Experiment

12,148 bytes added, 15:11, 6 December 2016
no edit summary
<p>&nbsp;</p>
 
<p><span style="font-size:14px">Western Blot</span></p>
 
<p>[[File:Ex1.png|400px]]</p>
 
<p>tx621(anti-mETP) - (mETP-spytag CM, TCE)</p>
 
<p>&nbsp;</p>
 
<p>pRA-mETP-SpyTag Size Exclusion &nbsp;</p>
 
<p>[[File:Ex2.jpg|400px]]</p>
 
<p>&nbsp;</p>
 
<p>(2)pTrc-Spe1-SpyCatcher-Xho1-APEX2</p>
 
<p>(E.Coli expression vector)</p>
 
<p>&nbsp;</p>
 
<p>(3) pTrc-Spe1-mETP-Xho1-APEX2</p>
 
<p>(E.Coli expression vector)</p>
 
<p>&nbsp;</p>
 
<p>(2) pTrc-Spe1-SpyCatcher-Xho1-APEX2 (E.Coli expression vector)</p>
 
<p>- APEX2 Sequence(318bp, 26.38kda)</p>
 
<p>Cgaaagtcttacccaactgtgagtgctgattaccaggacgccgttgagaaggcgaagaagaagctcagaggcttcatcgctgagaagagatgcgctcctctaatgctccgtttggcattccactctgctggaacctttgacaagggcacgaagaccggtggacccttcggaaccatcaagcaccctgccgaactggctcacagcgctaacaacggtcttgacatcgctgttaggcttttggagccactcaaggcggagttccctattttgagctacgccgatttctaccagttggctggcgttgttgccgttgaggtc</p>
 
<p>- SpyCatcher(385bp, 31.36kda)</p>
 
<p>ATGGTTGATACCTTATCAGGTTTATCAAGTGAGCA</p>
 
<p>AGGTCAGTCCGGTGATATGACAATTGAAGAAGATAGTGCTACCCATATTAAATTCTCAAAACGTGATGAG</p>
 
<p>GACGGCAAAGAGTTAGCTGGTGCAACTATGGAGTTGCGTGATTCATCTGGTAAAACTATTAGTACATGGA</p>
 
<p>TTTCAGATGGACAAGTGAAAGATTTCTACCTGTATCCAGGAAAATATACATTTGTCGAAACCGCAGCACC</p>
 
<p>AGACGGTTATGAGGTAGCAACTGCTATTACCTTTACAGTTAATGAGCAAGGTCAGGTTACTGTAAATGGC</p>
 
<p>AAAGCAACTAAAGGTGACGCTCATATTTAAATGGTTGATGCTTGAGGATCCGAATTCGAGCTCCGTCGAC</p>
 
<p>[[File:Ex3.jpg|400px]]</p>
 
<p>&nbsp;</p>
 
<p>(2) pTrc-Spe1-SpyCatcher-Xho1-APEX2 (E.Coli expression vector) sequencing data</p>
 
<p>[[File:Ex4.png|400px]]</p>
 
<p>*pTRC sequencing primer</p>
 
<p>F: 5&rsquo;-AGCTGTTGACAATTAATCATCCGGC-3&rsquo;</p>
 
<p>R: 5&#39;-TCTGCGTTCTGATTTAATCTGTATCAGGC-3&lsquo;</p>
 
<p>&nbsp;</p>
 
<p>(2)pTRC_APEX2_SpyCatcherSpe1Xho1(Spe1-SpyCatcher-Xho1)</p>
 
<p>[[File:Ex5.png|400px]]</p>
 
<p>(3) pTrc-Spe1-mETP-Xho1-APEX2(39.1kda) expected sequence</p>
 
<p>[[File:Ex6.png|400px]]</p>
 
<p>&nbsp;</p>
 
<p>(3) pTrc-Spe1-mETP-Xho1-APEX2 (E.Coli expression vector)</p>
 
<p>1.Add Spe1, Xho1 between mETP</p>
 
<p>&nbsp;</p>
 
<p>PCR(Ex-Nrg1)</p>
 
<p>-TDW :37.75ul</p>
 
<p>-10X EX Taq Buffer : 5ul</p>
 
<p>-Primer(R/F): &nbsp;1ul(per each)</p>
 
<p>-Template(mETP): 1ul(10ng) -----------X4(temperature gradient: 54,56,58,60)</p>
 
<p>-2.5mM dNTP MIX: 4ul</p>
 
<p>-Ex Taq Polymerase: 0.25ul</p>
 
<p>------------------------------</p>
 
<p>&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp;&nbsp; 50ul</p>
 
<p>&nbsp;</p>
 
<p>Purify</p>
<p>&nbsp;</p>
 
<p>-Use mini-prep kit</p>
 
<p>&nbsp;(PW buffer 650ul, product 50ul in column, 30sec centrifuge, discard bottom one and 1min centrifuge, transfer column to1.5ml tube, 2nd D.W 35ml , stand 1min, 1min centrifuge</p>
 
<p>-&gt;purified mETP Ex-Tag PCR product(56,58,60)</p>
 
<p>[[File:Ex7.jpg|400px]]</p>
 
<p>mETP(Spe1-mETP-Xho1) ExTaq gradient PCR(54,.56,58,60)</p>
<p>&nbsp;</p>
 
<p>&lt;T vector Cloning&gt;</p>
 
<p>-&gt; mETP Ex-Taq PCR (each end A exists) ligate into T vector(=pGEM-T easy vector, each end T exists), Transformation to E.coli</p>
<p>&nbsp;</p>
 
<p>-Ligation</p>
 
<p>-</p>
 
<p>-&gt;NEB Calculator site(nebiocalculator.net.com/#!/ligation) insert length(mETP =204, primer, total 222bp), vector length(T vector :3015bp), T vector mass</p>
 
<p>-&gt;3:1=&gt; insert 5.522ng</p>
 
<p>&nbsp;</p>
 
<p>-&gt; 2X Rapid Ligation buffer: 5ul</p>
 
<p>&nbsp;&nbsp;&nbsp; T vector: 0.5ul</p>
 
<p>&nbsp;&nbsp;&nbsp; PCR product(Insert):</p>
 
<p>&nbsp;&nbsp;&nbsp; D.W :</p>
 
<p>T4 DNA Ligase: 1ul</p>
 
<p>---------------------------------------</p>
 
<p>&nbsp;&nbsp; Total: 10ul</p>
 
<p>1hour RT incubation</p>
 
<p>&nbsp;</p>
 
<p>[[File:Ex8.jpg|400px]]</p>
 
<p>&lt;Colony PCR&gt;</p>
 
<p>T.D.W : 14.9</p>
 
<p>10X Buffer : 2</p>
 
<p>M13 primer Forward: 0.5</p>
 
<p>M13 primer Reverse: 0.5</p>
 
<p>2.5mM dNTP: 1.6</p>
 
<p>XL-Taq polymerase: 0.5</p>
 
<p>&nbsp;</p>
 
<p>Phusion Colony PCR</p>
 
<p>&nbsp;</p>
 
<p>Replica 4,7</p>
 
<p>Double Digestion</p>
 
<p>(1) pTrc Vector(pTrc-Spycatcher-APEX2,3410ng/ul): 5ug(1.5ul)</p>
 
<p>Enzyme(Spe1, Xho1): each 1.5ul</p>
 
<p>Buffer(Cutsmart,10X):1ul</p>
 
<p>T.D.W:4.5ul</p>
 
<p>------------------------------------------------------</p>
 
<p>10ul</p>
 
<p>&nbsp;</p>
 
<p>(2) pTrc Vector( expected to be Spycatcher Cut ,15ng/ul): 15ul(225ng)</p>
 
<p>Enzyme(Spe1, Xho1):&nbsp; 1ul(each)</p>
 
<p>Buffer(Cutsmart,10X): 2ul</p>
 
<p>T.D.W:1</p>
 
<p>------------------------------------------------------</p>
 
<p>20ul</p>
 
<p>&nbsp;</p>
 
<p>(3) mETP T-vector</p>
 
<p>-&gt; Restriction Enzyme(Spe1, Xho1): 1.5ul 씩</p>
 
<p>-&gt; Tvector(735ng/ul): 6.8ul(5ng)</p>
 
<p>-&gt; 10X Buffer: 2ul</p>
 
<p>-&gt; T.D.W: 8.2ul</p>
 
<p>--------------------------------------------------</p>
 
<p>&nbsp;20ul</p>
 
<p>&nbsp;</p>
 
<p>37 celcius incubation</p>
 
<p>[[File:Ex9.png|400px]]</p>
 
<p>&nbsp;</p>
 
<p>Ligation</p>
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
 
<p>-&gt; Insert: 212bp</p>
 
<p>-&gt; Vector DNA mass: 50ng</p>
 
<p>-&gt; 3:1</p>
 
<p>=&gt; Insert DNA mass: 7.227ng</p>
 
<p>&nbsp;</p>
 
<p>10X T4 DNA Ligase buffer: 3ul</p>
 
<p>Vector DNA: 50ng(17ul)</p>
 
<p>Insert DNA: 7.227ng(2.06ul)</p>
 
<p>D.W: 6.94ul</p>
 
<p>T4 DNA Ligase: 1ul</p>
 
<p>---------------------------------------------------------------</p>
 
<p>Total: 30ul</p>
 
<p>RT incubation</p>
 
<p>&nbsp;</p>
 
<p>-&gt;Transformation</p>
 
<p>&nbsp;</p>
 
<p>-&gt; Colony: 4</p>
 
<p>-&gt; incubation</p>
 
<p>-&gt;Mini-prep</p>
 
<p>-&gt; 1.5% gel, 4 Digestion</p>
 
<p>[[File:Ex10.png|400px]]</p>
 
<p>pTrc Spe1-mETP-Xho1 colony(1,2,3,4)</p>
 
<p>Double Digestion</p>
 
<p>&nbsp;</p>
 
<p>(3) pTrc-Spe1-mETP-Xho1-APEX2 (E.Coli expression vector) sequencing result</p>
 
<p>[[File:Ex11.png|400px]]</p>
 
<p>&nbsp;</p>
 
<p>(2) pTrc-Spe1-SpyCatcher-Xho1-APEX2 (E.Coli expression vector)</p>
 
<p>(3) pTrc-Spe1-mETP-Xho1-APEX2 (E.Coli expression vector) sequencing result</p>
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
 
<p>(1)Protein expression by transformation on Ecoli(BL21)</p>
 
<p>*Store each of E.coli in -80 celcius Deep Freezer</p>
 
<p>&nbsp;</p>
 
<p>(2)Do IPTG induction test(small scale) to check whether it is soluble, overexpress or not</p>
 
<p>&nbsp;</p>
 
<p>(3) Get protein &amp; purify!</p>
 
<p>&nbsp;</p>
 
<p>&lt;Protein induction &amp; soluble test protocol&gt;</p>
 
<p>&nbsp;</p>
 
<p>1.Incubate E.coli with 5ml+antibiotic LB&nbsp; (previous day)</p>
 
<p>●</p>
 
<p>2.Dilute up to 1:50(2%) and incubate with new bottle</p>
 
<p>●</p>
 
<p>3.Incuabte until OD(optical density) reach 0.5~0.8 &nbsp;at 600nm. Then, divide it into 1.5ml tube 200ul tube(IPTG(-), store at 4 celcius)</p>
 
<p>●</p>
 
<p>4.Treat IPTG(=molecular biology reagent) &nbsp;(final: 0.5mM/L , 1M*xL = 0.5mM*yL)</p>
 
<p>Ex:&nbsp;&nbsp;&nbsp; For 200ml, 100ul 1M IPTG is needed</p>
 
<p>&nbsp;</p>
 
<p>5. Incubate ITPG treated with 37 celcius shaker about 3.5 hours</p>
 
<p>&nbsp;</p>
 
<p>6. Divide it into 1.5ml tube 200ul (14000rpm,1min centrifuge, label IPTG(+) Sup &nbsp;to Sup(supernatant, Wash the ppt(pallet) with T.D.W 50ul and label it to IPTG(+) PPT and store both with 4 celcius )</p>
 
<p>&nbsp;</p>
 
<p>7. Centrifuge rest of them (4000rpm, 15min) &amp; remove sup</p>
 
<p>&nbsp;</p>
 
<p>8. Resuspension it with Phosphate buffer(=Ni-NTA wash buffer, (20mM Tris HCl(pH 8), 150mM NaCl, 20mM Imidazole))</p>
 
<p>&nbsp;</p>
 
<p>9. &nbsp;centrifuge, remove sup</p>
 
<p>10. Resuspension each with (1L: 30~35ml wash buffer )</p>
 
<p>&nbsp;</p>
 
<p>11. Treat Lysozyme(50ul per 1L) and incubate it with shaking (0.5~1h RT)</p>
 
<p>&nbsp;</p>
 
<p>12. sonication(20 amplitude, 10min(processing time : 5min)</p>
 
<p>&nbsp;</p>
 
<p>13. Take 50ul and divide it into ppt&amp;SUP to check solubility</p>
 
<p>&nbsp;</p>
 
<p>14. Centrifuge Rest of them except 50ul with 10000rpm, isolate Sup and ppt. Label each of them with IPTG(+) sonication(+) sup, ppt, IPTG(+) sonication(-) sup, ppt</p>
 
<p>&nbsp;</p>
 
<p>15. Mix Labeled with 5X SDS buffer and boil it with 100 celcius(5~10min)</p>
 
<p>&nbsp;</p>
 
<p>* Store it in -20 celcius</p>
 
<p>&nbsp;</p>
 
<p>pTrc-Spe1-mETP-Xho1-APEX2 protein size</p>
 
<p>Open reading frame(ORF): 1068bp, 355 amino acids, 39.1kDa</p>
 
<p>&nbsp;</p>
 
<p>&THORN;10% gel commassie blue(60v-&gt;120v)</p>
 
<p>[[File:Ex12.png|400px]]</p>
 
<p>&nbsp;</p>
 
<p>(3) pTrc-Spe1-mETP-Xho1-APEX2 protein his column purification</p>
 
<p>(E.Coli expression vector)</p>
 
<p>[[File:Ex13.jpg|400px]]</p>
 
<p>&nbsp;</p>
 
<p>His column purification Comassie blue staining</p>
 
<p>[[File:Ex14.png|400px]]</p>
 
<p>(3) pTrc-Spe1-mETP-Xho1-APEX2 protein</p>
 
<p>&nbsp;</p>
 
<p>#19 size exclusion(purification)</p>
 
<p>[[File:Ex15.jpg|400px]]</p>
 
<p>(3) pTrc-Spe1-mETP-Xho1-APEX2 protein</p>
 
<p>&nbsp;</p>
 
<p>(1)pRA-GFP-pRL-mETP-SpyTag-Stop-Xho1 (mammalian expression vector)</p>
 
<p>&amp;&nbsp;(2) pTrc-Spe1-SpyCatcher-Xho1-APEX2</p>
 
<p>(E.Coli expression vector)&nbsp;</p>
 
<p>Binding test</p>
 
<p>(protein to protein)</p>
 
<p>[[File:Ex16.png|400px]]&nbsp;[[File:Ex17.jpg|400px]]&nbsp;</p>
 
<p>* pRA-mETP-SpyTag_CM 10ul(concentrated)</p>
 
<p>pTrc-Spycatcher 200ng, 500ng, 100ng, 200ng, 500ng, 1000ng</p>
 
<p>&nbsp;binding test(Anti His) (15%)</p>
 
<p>* pRA-mETP-SpyTag_CM 10ul(concentrated)</p>
 
<p>pTrc-Spycatcher 200ng, 500ng, 100ng, 200ng, 500ng, 1000ng</p>
 
<p>binding test(Anti mETP(Tx621))(15%)</p>
 
<p>&nbsp;</p>
 
<p>Further study &amp; Prospect</p>
 
<p>&nbsp;</p>
 
<p>-Do protein interaction experiment in cell to see whether it is well connected in vitro</p>
 
<p>-</p>
 
<p>-</p>
 
<p>-Find the protein that is correlated with mETP through &lsquo;mass spectroscopy&rsquo; technique</p>
 
<p>&nbsp;</p>
 
<p>&nbsp;&nbsp;&nbsp; -&gt; Therefore, we can identify unknown &lsquo;protein&rsquo; and its gene and their location.</p>
 
<p>&nbsp;</p>
 
<p>-Applied to Genomics</p>
 
<p>&nbsp;&nbsp;&nbsp;</p>
 
<p>&nbsp;&nbsp;-&gt; Analyze how different, how overexpressed, how different of unknown &lsquo;protein&rsquo; gene between obese people to lean people by genome sequencing of certain region of unknown &lsquo;protein&rsquo; gene</p>
 
<p>&nbsp;</p>
 
<p>&nbsp;</p>
 
<p>Reference</p>
 
<p>&nbsp;</p>
 
<p>-&nbsp;&nbsp; Definition of Proteomics <a href="http://biolecture.org/index.php/Proteomics">http://</a><a href="http://biolecture.org/index.php/Proteomics">biolecture.org/index.php/Proteomics</a></p>
 
<p>-&nbsp;&nbsp; Definition of Omics <a href="http://biolecture.org/index.php/Omics">http</a><a href="http://biolecture.org/index.php/Omics">://</a><a href="http://biolecture.org/index.php/Omics">biolecture.org/index.php/Omics</a></p>
 
<p>-Bhak, J. (2016, 6 13). Openfree biolecture. Retrieved from Openfree biolecture: <u><a href="http://biolecture.org/index.php/SELF:_Self_evaluating_learning_framework">http://biolecture.org/index.php/SELF:_Self_evaluating_learning_framework</a></u></p>
 
<p>-Endotrophin triggers adipose tissue fibrosis and metabolic dysfunction. <u><a href="https://www.ncbi.nlm.nih.gov/pubmed/24647224">https://www.ncbi.nlm.nih.gov/pubmed/24647224</a></u></p>
 
<p>-Adipocyte-derived endotrophin promotes malignant tumor progression</p>
 
<p><u><a href="https://www.jci.org/articles/view/63930">https://www.jci.org/articles/view/63930</a></u></p>
 
<p>-Secrets of a covalent interaction for biomaterials and biotechnology: SpyTag and SpyCatcher.</p>
 
<p><u><a href="https://www.ncbi.nlm.nih.gov/pubmed/26517567">https://www.ncbi.nlm.nih.gov/pubmed/26517567</a></u></p>
 
<p>-Directed evolution of APEX2 for electron microscopy and proximity labeling.</p>
 
<p><u><a href="https://www.ncbi.nlm.nih.gov/pubmed/25419960">https://www.ncbi.nlm.nih.gov/pubmed/25419960</a></u></p>
 
<p>-From genomics to proteomics (Nature Review)</p>
 
<p><u><a href="http://www.nature.com/nature/journal/v422/n6928/full/nature01510.html">http://www.nature.com/nature/journal/v422/n6928/full/nature01510.html</a></u></p>
 
<p>-Innovation: Metabolomics: the apogee of the omics trilogy</p>
 
<p><u><a href="http://www.nature.com/nrm/journal/v13/n4/abs/nrm3314.html">http://www.nature.com/nrm/journal/v13/n4/abs/nrm3314.html</a></u></p>
 
<p>-Mass-spectrometric exploration of proteome structure and function</p>
 
<p><u><a href="http://www.nature.com/nature/journal/v537/n7620/abs/nature19949.html">http://www.nature.com/nature/journal/v537/n7620/abs/nature19949.html</a></u></p>
<p>&nbsp;</p>
Anonymous user