Changes
From Biolecture.org
no edit summary
<strongp><font size="4">Recurring Mutations Found by Sequencing an Acute Myeloid Leukemia Genome. <br /p> <p></fontstrong>Obese in Genomics</strong><br /p>Mardis ER, Ding L, Dooling DJ, Larson DE, McLellan MD, Chen K, Koboldt DC, Fulton RS, Delehaunty KD, McGrath SD, Fulton LA, Locke DP, Magrini VJ, Abbott RM, Vickery TL, Reed JS, Robinson JS, Wylie T, Smith SM, Carmichael L, Eldred JM, Harris CC, Walker J, Peck JB, Du F, Dukes AF, Sanderson GE, Brummett AM, Clark E, McMichael JF, Meyer RJ, Schindler JK, Pohl CS, Wallis JW, Shi X, Lin L, Schmidt H, Tang Y, Haipek C, Wiechert ME, Ivy JV, Kalicki J, Elliott G, Ries RE, Payton JE, Westervelt P, Tomasson MH, Watson MA, Baty J, Heath S, Shannon WD, Nagarajan R, Link DC, Walter MJ, Graubert TA, Dipersio JF, Wilson RK, Ley TJ<p> </p> <p><strong>What is Obese?</strong></p> <div>-Obesity is a <a href="https://en.wikipedia. <br org/wiki/Medical_condition">medical condition<br /a>From the Departments of Genetics (Ein which excess <a href="https://en.Rwikipedia.Morg/wiki/Body_fat">body fat</a> has accumulated to the extent that it may have a negative effect on health., L.D., V</div> <div> </div> <div>-People are generally considered obese when their <a href="https://en.J.M., R.K.W., T.J.Lwikipedia.org/wiki/Body_mass_index">body mass index</a> (BMI), Medicine (R.E.R.a measurement obtained by dividing a person's weight by the square of the person's height, P.Wis over 30 <a href="https://en., Mwikipedia.Horg/wiki/Kilogram">kg</a>/<a href="https://en.Twikipedia., Sorg/wiki/Square_metre">m</a><a href="https://en.Hwikipedia.org/wiki/Square_metre">2</a> , W.D.Swith the range 25–30 <a href="https://en., Dwikipedia.Corg/wiki/Kilogram">kg</a>/<a href="https://en.Lwikipedia., Morg/wiki/Square_metre">m</a><a href="https://en.Jwikipedia.W., T.A.G., Jorg/wiki/Square_metre">2</a> defined as <a href="https://en.Fwikipedia.D., T.J.L.), and Pathology and Immunology (Jorg/wiki/Overweight">overweight</a></div> <div> </div> <div>-Obesity increases the likelihood of <a href="https://en.E.P., M.A.Wwikipedia.org/wiki/Obesity-associated_morbidity">various diseases</a>, Rparticularly <a href="https://en.N.); the Genome Center (E.R.Mwikipedia.org/wiki/Cardiovascular_diseases">heart disease</a>, L<a href="https://en.Dwikipedia.org/wiki/Diabetes_mellitus_type_2">type 2 diabetes</a>, D<a href="https://en.J.Dwikipedia.org/wiki/Obstructive_sleep_apnea">obstructive sleep apnea</a>, Dcertain types of <a href="https://en.E.Lwikipedia.org/wiki/Cancer">cancer</a>, M.D.Mand <a href="https://en., Kwikipedia.Corg/wiki/Osteoarthritis">osteoarthritis</a>., D.C.K., R.S</div> <div> </div> <div>-Obesity is most commonly caused by a combination of excessive <a href="https://en.Fwikipedia.org/wiki/Food_energy">food</a> intake, K.D.D.lack of physical activity, Sand <a href="https://en.Dwikipedia.Morg/wiki/Polygenic_inheritance">genetic susceptibility</a>., L.A.F., D.P.L., V.J.M., R.M.A., T.L.V., J.S. Reed, J.S. Robinson, T.W., S.M.S., L.C., J.M.E., C.C.H., J.W., J.B.P., F.D., A.F.D</div> <div> </div> <div><p> </p> <p><strong>Arrangement of basic terms in Genomics</strong></p> <p> </p> <p><strong>What is Genomics?</strong></p></div> <p>Genomics is the <a href="http://biopedia., Gorg/index.E.S., A.M.Bphp/Omics">omics</a> study of <a href="http://biopedia., E.Corg/index.php/Gene">genes</a> of individual organisms, J.F.M. populations, R.Jand <a href="http://biopedia.Morg/index., J.K.S., C.S.Pphp/Species">species</a>.</p> <p>Paradigm of performing biological science that deviates from investigating single genes, J.W.W.their functions, Xand roles.S., L.L., H.S., Y.T., C.H., M.E.W., J.V.I., J</p> <p> </p> <p><strong>What is Omics?</strong></p> <p>General term for a broad discipline of science and engineering</p> <p>Analyzing the interactions of biological information objects in various <a href="http://omics.Korg/index., G.E., M.A.W., R.K.W., T.J.L.)php?title=Omes& Siteman Cancer Center (P.W., M.H.T., M.A.W., S.H., W.D.S., R.N., D.C.L., M.J.W., T.A.G., J.F.D., R.K.W., T.J.L.action=edit">omes</a> in biology</p> <p><strong>Main focus</strong></p> <div>1)mapping information objects such as genes and proteins</div> <div><strong><u>2); and finding interaction relationships among the Division of Biostatistics (J.B.) - all at Washington University, St. Louis. This article (10.1056objects</NEJMoa0903840) was published on August 5, 2009, at NEJM.org. u><br /strong><br /div> <strongdiv>BACKGROUND</strong>: The full complement of DNA mutations that are responsible for 3)engineering the networks and objects to understand and manipulate the pathogenesis of acute myeloid leukemia (AML) is not yet known.regulatory mechanisms</div> <div> <br /div> <strongdiv>METHODS </strongdiv>: We used massively parallel DNA sequencing to obtain a very high level of coverage (approximately 98%) of a primary, cytogenetically normal, de novo genome for AML with minimal maturation (AML-M1) and a matched normal skin genome. <br /div><strong>RESULTSWhat is Proteomics?</strong>: We identified 12 acquired (somatic) mutations within the coding sequences of genes and 52 somatic point mutations in conserved or regulatory portions of the genome.</div> <div> <br /div>All mutations appeared to be heterozygous and present in nearly all cells in the tumor sample.<div><p>Omics study of <br />Four of the 64 mutations occurred in at least 1 additional AML sample in 188 samples that were tested.proteins, particularly their structures, sequences, and functions.<br /p>Mutations in NRAS and NPM1 had been identified previously in patients with AML, but two other mutations had not been identified. One of these mutations, in the IDH1 gene, was present in 15 of 187 additional AML genomes tested and was strongly associated with normal cytogenetic status<p> it was present in 13 of 80 cytogenetically normal samples (16%(which proteins interact). <br /p>The other was a nongenic mutation in a genomic region with regulatory potential and conservation in higher mammals; we detected it in one additional AML tumor.<p> <br /p> <p>The AML genome that we sequenced contains approximately 750 point mutations, set of which only a small fraction are likely to be relevant to pathogenesisproteins produced by it during its life, and its genome is its set of genes.</p> <p> <br /p> <strongp>CONCLUSIONS</strong>: By comparing A proteome differs from cell to cell and constantly changes through its biochemical interactions with the sequences of tumor genome and skin genomes of a patient with AML-M1, we have identified recurring mutations that may be relevant for pathogenesisthe environment. <br /p><br /><strongp>69.9 billion base pairs were sequenced (23.3<font face="arial=> One organism has radically different protein expression in different parts of its body,helvetica">xdifferent stages of its life cycle and different environmental conditions</font> haploid coverage)</strong><br /p><br />Copyright 2009 Massachusetts Medical Society. <br /p>*There are far fewer protein-coding genes in the human genome than proteins in the human proteome (20,000 to 25,000 genes vs. > 500,000 proteins)<br /p> <a hrefp>="http://content.nejm.org> Protein diversity is thought to be due to alternative splicing and post-translational modification of proteins</cgi/content/full/NEJMoa0903840"p>http://content.nejm.org/cgi/content/full/NEJMoa0903840 </ap> <br /p> <br /p>New methods include protein microarrays, <u><strong>immunoaffinity chromatography followed by mass spectrometry(MALDI-TOF mass spectrometry),<a href="http:/strong> </contentu>and combinations of experimental methods such as phage display and computational methods.nejm.org/cgi/reprint</NEJMoa0903840v1.pdf"p>http <p> </p> <p><strong>What is Metabolome?</strong></p> <p> </p> <p>Interaction between an organism’s genome and its environment</p> <p> </p> <p>Complete set of <a href="https://content.nejm.org/cgi/reprint/NEJMoa0903840v1.pdf//en.wikipedia.org/wiki/Small_molecule">small-molecule</a> chemicals found within a biological sample.</p> <p> </p> <p>The <a href="https://en.wikipedia.org/wiki/Small_molecule">small molecule</a> chemicals found in a given metabolome may include both endogenous <a href="https://en.wikipedia.org/wiki/Metabolites">metabolites</a> that are naturally produced by an <a href="https://en.wikipedia.org/wiki/Organism">organism</a> as well as exogenous chemicals</p> <p> </p> <p><strong>The endogenous metabolome</strong></p> <p>-> primary metabolome</p> <p>-> Secondary metabolome</p> <p> </p> <p><a href="https://en.wikipedia.org/wiki/Primary_metabolite">* primary metabolite</a> is directly involved in the normal growth, development, and reproduction.</p> <p><a href="https://en.wikipedia.org/wiki/Secondary_metabolite">*secondary metabolite</a> is not directly involved in those processes, but usually has important ecological function(ex: <a href="https://en.wikipedia.org/wiki/Pigments">pigments</a>, <a href="https://en.wikipedia.org/wiki/Antibiotics">antibiotics</a> or waste products derived from partially metabolized <a href="https://en.wikipedia.org/wiki/Xenobiotics">xenobiotics</a>)</p> <p><a href="https://en.wikipedia.org/wiki/NMR_spectroscopy">Use NMR spectroscopy</a> and <a href="https://en.wikipedia.org/wiki/Mass_spectrometry">mass spectrometry</a>.</p> <p> </p> <p> </p> <p><strong>The Human Metabolome Database</strong></p> <p> </p> <p>Contain detailed data on more than 40,000 metabolites that have already been identified or are likely to be found in the human body</p> <p> </p> <div>1)Chemical information</div> <p>- includes >40,000 metabolite structures with detailed descriptions, extensive chemical classifications, synthesis information and observed/calculated chemical properties</p> <div> </div> <div>2)Clinical information</div> <p>- includes data on >10,000 <a href="https://en.wikipedia.org/wiki/Metabolite">metabolite</a>-<a href="https://en.wikipedia.org/wiki/Biofluid">biofluid</a> concentrations, metabolite concentration information on more than 600 different human diseases and pathway data for more than 200 different inborn errors of metabolism.</p> <div> </div> <div> </div> <div>3)Biochemical information.</div> <p>- includes nearly 6000 protein (and DNA) sequences and more than 5000 biochemical reactions that are linked to these metabolite entries</p></div> <p> </p> <p>---------------------------------------------</p> <p>Obese</p> <p> </p> <p>-> Mainly Influenced by External effects!</p> <p>-> The Disease that can be cured!</p> <p>-> Obese parents usually have obese children!</p> <p> </p> <p><strong><u>Therefore, Focus more on protemoics, Metabolome!</u></strong></p> <p> -----------------------------------------------------------------------</p> <p><strong><span style="font-size:14px">Adipose tissue</span></strong></p> <p> </p> <p><strong>-> Adipokine </strong></p> <p> -> <span style="font-size:12px"><span style="color:black; font-family:맑은 고딕">Adipose tissue secreted multiple mediator</span></span></p> <p><span style="font-size:12px"><span style="color:black; font-family:맑은 고딕"> </span></span>-> Passed through either endocrine or paracrine</p> <p> Ex: Hormone: leptin, adiponectin</p> <p> </p> <p><strong>-> Adiponectin</strong></p> <p><strong> -> </strong>Adipocyte-secreted adipokine</p> <p> -> Increase lipid oxidation& anti-inflammatory, insulin-sensitizing, angiogenic action</p> <p> <strong>=> Anti obesity & Antidiabetic, Decrease insulin resistance </strong></p> <p> [[File:1.png|400px]]</p> <p> </p> <p> </p> <p> [[File:2.gif|400px]]</p> <p>-> Illustration of the major physiological and metabolic</p> <p>processes with which adipose tissue is involved through the secretion</p> <p>of various adipokines from adipocytes. The interactions may be</p> <p>autocrine, paracrine, or endocrine.</p> <p> </p> <p><span style="font-size:16px"><strong><Searching Scientific Reports></strong></span></p> <p> [[File:3.png|400px]]</p> <p> [[File:4.png|400px]]</p> <p> </p> <p><strong><span style="font-size:16px"><What is Col6?></span></strong></p> <p>- COL6 = Collagen type 6</p> <p>- Abundant constituent of white adipose tissue (WAT)</p> <p>- COL6 levels positively correlate with hyperglycaemia and insulin resistance</p> <p>- Composed of three distinct a chains, a1, a2 and a3.(COL6 trimeric building block) and are subsequently secreted into the ECM</p> <p> </p> <p><strong><span style="font-size:16px"><What is a3 Chain?></span></strong></p> <p>-> longest of the three chains</p> <p>- contains an unusually long N terminus and a globular C5 domain at the C-terminus</p> <p> </p> <p>-> C-terminal portion of the a3 subunit is cleaved off during the post-translational processing of COL6 fibrils(COL6a3, Endotrophin)</p> <p> </p> <p><strong><span style="font-size:16px"><What is Endotrophin?></span></strong></p> <p>- Adipokine with potent tumour-promoting effects</p> <p>- Plays a pivotal role in shaping a metabolically unfavorable microenvironment in adipose tissue during consumption of a high-fat diet (HFD)</p> <p>- Powerful co-stimulator of pathologically relevant pathways within the ‘unhealthy’ adipose tissue milieu, triggering fibrosis and inflammation and ultimately leading to enhanced insulin resistance& metabolic dysfunction.</p> <p>- Exerts a major influence in adipose tissue</p> <p>- Endotrophin within the tumor microenvironment serves as a major mediator of COL6-stimulated mammary tumor growth and subsequent chemo resistance</p> <p>- Stimulates fibrosis, activates endothelial cell migration and promotes macrophage infiltration into growing solid tumors.</p> <p>=> elevated mammary tumor expansion and more pronounced metastatic growth</p> <p> [[File:5.png|400px]]</p> <p>---------------------------------------------------------</p> <p><u><strong><span style="font-size:18px">Problem!</span></strong></u></p> <p> </p> <p><strong>-> Don’t know the mechanism of how ETP works.</strong></p> <p> </p> <p><u><strong><span style="font-size:16px">What I’m going to do!</span></strong></u></p> <p> </p> <div><strong>-> Find the Receptor according to the New method of Protemoics.</strong></div> <div><strong>-> Find the interaction, relationship and mechanisms how they act.(Study of Omics)</strong></div> <div><u><strong> -> Omics could be applied to genomics perspective!</strong></u></div> <p> </p> <p> </p> <p>mETP(204bp, 16.43kda)</p> <p>ACAGAACCATTGTTTCTCACTAAAACAGATATATGTAAGCTGTCCAGAGATGCTGGGACTT</p> <p>GTGTGGACTTCAAGTTACTATGGCACTATGACCTAGAGAGCAAAAGTTGCAAGAGATTCTG</p> <p>GTATGGAGGTTGTGGAGGCAACGAGAACAGATTCCACTCCCAGGAAGAATGTGAAAAGATGTGTAGTCCTGAGTTAACAGTT</p> <p> </p> <p>SpyTag(39bp, 16.43kda)</p> <p>GCCCACATCGTGATGGTGGACGCCTACAAGCCGACGAAG</p> <p> </p> <p>pRL(90bp, 7.48kda)</p> <p>ATGGACAGCAAAGGTTCGTCGCAGAAAGGGTCCCGCCTGCTCCTGCTGCTGGTGGTGTCAAATCTACTCTTGTGCCAGGGTGTGGTCTCC</p> <p> </p> <p>(1)</p> <p> [[File:12.png|600px]]</p> <p> pRA-GFP-EcoR1-pRL-unknown-mETP-SpyTag-Stop</p> <p> </p> <p>-><strong> How to make this cloning?</strong></p> <p>(1)By Using pRL-EcoR1 forward primer, mETP-SpyTag-Stop-Xho1 primer, make pRL-EcoR1-mETP-SpyTag-Stop-Xho1 by Ex-Tag PCR</p> <p>[[File:13.png|500px]]</p> <p>(2) Insert template gained from (1) in T-Vector to check whether it is really pRL-EcoR1-mETP-SpyTag-Stop-Xho1 or not.</p> <p>(3) Use EcoR1, Xho1 Digestion enzyme to double digest T vector</p> <p>(4) Double Digest pRA GFP vector(empty vector) and purify it.</p> <p>(5) ligate (3), (4) product</p> <p> </p> <p><strong>-> Detailed on Each Steps</strong></p> <p>(1) Ex-Tag PCR process</p> <p> </p> <p>->Template(pRA-GFP, 20ng): 1ul</p> <p>->Primer: 1,1ul</p> <p>->dNTP(10nM): 1ul</p> <p>->10X Ex-Tag Buffer: 2.5ul</p> <p>-> Ex-Tag polymerase: 1ul</p> <p>-> D.W: 17.5ul</p> <p>----------------------------------------</p> <p>Total: 25ul</p> <p> </p> <p>PCR</p> <p>->Temperature Gradient : 54,56,58</p> <p>->98 celsius : 2min</p> <p>->98 celsius : 10sec</p> <p>->57 celsius : 30sec</p> <p>->72 celsius : 30sec(insert 300bp)</p> <p>->72 celsius : 5min</p> <p>X35</p> <p> [[File:14.png|400px]]</p> <p>-> Can see the insert(300bp) in both 54,56,58 temperature gradient!</p> <p> </p> <p> (2)</p> <p><T vector ligation></p> <p>Insert DNA mass: 8.607ng(3:1)</p> <p>2X Rapid ligation: 5ul</p> <p>T vector: 0.5ul(25ng)</p> <p>PCR product: 1ul(8.7ng)</p> <p>D.W: 2.5ul</p> <p>T4 DNA Ligase: 1ul</p> <p>----------------------------</p> <p>Total: 10ul</p> <p>RT 1 hour incubation</p> <p>Then, Transformation</p> <p> </p> <p><Colony PCR></p> <p>-> Check whether insert base pairs is inserted in T vector well</p> <p>T.D.W : 14.9</p> <p>10X Buffer : 2</p> <p>M13 primer Forward: 0.5</p> <p>M13 primer Reverse: 0.5</p> <p>2.5mM dNTP: 1.6</p> <p>XL-Taq polymerase: 0.5</p> <p> ---------------------------------</p> <p>[[File:15.jpg|400px]]</p> <p>Can check on 3,5 well(T vector 200bp+ 346bp = 500~600bp)</p> <p> </p> <p> (3)</p> <p> </p> <p> </p> <p>------------------------------------------------------------</a><br /p><br /><a href="http://www.ncbi.nlm.nih.gov/pubmed/19657110?ordinalpos=1&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DefaultReportPanel.Pubmed_RVDocSum"p>http://www.ncbi.nlm.nih.gov/pubmed/19657110?ordinalpos=1&itool=EntrezSystem2.PEntrez.Pubmed.Pubmed_ResultsPanel.Pubmed_DefaultReportPanel.Pubmed_RVDocSum[[20131571 조우빈]]</ap>
