Changes
From Biolecture.org
no edit summary
<pstyle="text-align:center"><span style="font-size:26px">Essay 6 - About the Blast and BLAT.</span>JaeYun Hyun</p>
<p>Major 1stIn <a href="https://en.wikipedia.org/wiki/Bioinformatics" title="Bioinformatics">bioinformatics</a>, <strong>BLAST</strong> for <strong>B</strong>asic <strong>L</strong>ocal <strong>A</strong>lignment <strong>S</strong>earch <strong>T</strong>ool is an <a href="https://en.wikipedia.org/wiki/Algorithm" title="Algorithm">algorithm</a> for comparing <a href="https://en.wikipedia.org/wiki/Primary_structure" title="Primary structure">primary</a> biological sequence information, such as the <a href="https://en.wikipedia.org/wiki/Amino_acid" title="Amino acid">amino-Chemical Engineeringacid</a> sequences of <a href="https://en.wikipedia.org/wiki/Protein" title="Protein">proteins</a> or the <a href="https://en.wikipedia.org/wiki/Nucleotide" title="Nucleotide">nucleotides</a> of <a href="https://en.wikipedia.org/wiki/DNA_sequence" title="DNA sequence">DNA sequences</a>. A BLAST search enables a researcher to compare a query sequence with a library or <a href="https://en.wikipedia.org/wiki/Database" title="Database">database</a> of sequences, and identify library sequences that resemble the query sequence above a certain threshold.</p>
<p>I want to write about the <strong>BLAT</strong> (<a href="https://en.wikipedia.org/wiki/BLAST" title="BLAST">BLAST</a>-like alignment tool) is a <a href="https://en.wikipedia.org/wiki/Sequence_alignment" title="Sequence alignment">pairwise sequence alignment</a> <a href="https://en.wikipedia.org/wiki/Algorithm" title="Algorithm">algorithm</a> that was developed by <a href="https://en.wikipedia.org/wiki/Jim_Kent" title="Jim Kent">Jim Kent</a> at the <a href="https://en.wikipedia.org/wiki/University_of_California_Santa_Cruz" title="University of California Santa Cruz">University of California Santa Cruz</a> (UCSC) in the early 2000s to assist in the assembly and annotation of the 2nd<a href="https://en.wikipedia.org/wiki/Human_Genome" title="Human Genome">human genome</a>.<span style="font-Bioengineeringsize:10.8333px"> </span>It was designed primarily to decrease the time needed to align millions of mouse genomic reads and <a href="https://en.wikipedia.org/wiki/Expressed_sequence_tags" title="Expressed sequence tags">expressed sequence tags</a> against the human genome sequence. The alignment tools of the time were not capable of performing these operations in a manner that would allow a regular update of the human genome assembly. Compared to pre-existing tools, BLAT was ~500 times faster with performing <a href="https://en.wikipedia.org/wiki/MRNA" title="MRNA">mRNA</a>/<a href="https://en.wikipedia.org/wiki/DNA" title="DNA">DNA</a> alignments and ~50 times faster with <a href="https://en.wikipedia.org/wiki/Protein" title="Protein">protein</a>/protein alignments.</p>
<p>BLAT is one of multiple algorithms developed for the analysis and comparison of biological sequences such as DNA, RNA and proteins, with a primary goal of inferring <a href="https://en.wikipedia.org/wiki/Homology_(biology)" title="Homology (biology)">homology</a> in order to discover biological function of genomic sequences. eIt is not guaranteed to find the mathematically optimal alignment between two sequences like the classic Needleman-mailWunsch and Smith-Waterman <a href="https: //en.wikipedia.org/wiki/Dynamic_programming" title="Dynamic programming">dynamic programming</a> algorithms do; rather, it first attempts to rapidly detect short sequences which are more likely to be homologous, and then it aligns and further extends the homologous regions. It is similar to the <a href="mailtohttps://en.wikipedia.org/wiki/Heuristic_(computer_science)" title="Heuristic (computer science)">heuristic</a> BLAST family of algorithms, but each tool has tried to deal with the problem of aligning biological sequences in a timely and efficient manner by attempting different algorithmic techniques.</p> <p>If I want to find the zebrafish apex1 gene's gRNA target site,</p> <p>we need forward primer and reverse primer and target sequence. </p> <p>zebrafish apex1 gene is on the chr 4, and target sequence is GGCTGCCCGGCCGTCCTTAC</p> <p>Forward primers sequence is </p> <table border="0" cellpadding="0" cellspacing="0" style="width:352px"> <tbody> <tr> <td>AAAGAGTTTGCATCCTCACAG</td> </tr> </tbody></table> <p>Reverse primer sequence is </p> <table border="0" cellpadding="0" cellspacing="0" style="width:352px"> <tbody> <tr> <td>CAAGTCCGTTCTTTTTGACC</td> </tr> </tbody></table> <p>Then visit http://genome.ucsc.edu/cgi-bin/hgBlat</p> <p> </p> <p><img alt="" src="/ckfinder/userfiles/images/dd(1).PNG" style="height:hat203@naver768px; width:1366px" /><img alt="" src="/ckfinder/userfiles/images/d.comPNG"style="height:768px; width:1366px" />hat203@naver<img alt="" src="/ckfinder/userfiles/images/sd.comPNG" style="height:768px; width:1366px" /></ap> <p>Like this way, we can find the zebrafish's apex1 gene gRNA target site and which exon was targeted. </p>
<p> </p>
<p> </p>
<p>[[GenomicsReference</p> <p><br />1. https:epigenomics]]//en.wikipedia.org/wiki/BLAST</p> <p>2. https://en.wikipedia.org/wiki/BLAT_(bioinformatics)</p> <p>3. http://genome.ucsc.edu/cgi-bin/hgBlat</p>
<p>[[About Darwin4.'nbsp;s theory]] <cite>Kent, W James (2002). <a href="http://view.ncbi.nlm.nih.gov/pubmed/11932250" rel="nofollow">"BLAT--the BLAST-like alignment tool"</a>. <em>Genome Research</em>. <strong>12</strong> (4): 656–664. <a href="https://en.wikipedia.org/wiki/Digital_object_identifier" title="Digital object identifier">doi</a>:<a href="https://dx.doi.org/10.1101%2Fgr.229202" rel="nofollow">10.1101/gr.229202</a>. <a href="https://en.wikipedia.org/wiki/PubMed_Central" title="PubMed Central">PMC</a> <a href="https://www.ncbi.nlm.nih.gov/pmc/articles/PMC187518" rel="nofollow">187518</a><img alt="Freely accessible" src="https://upload.wikimedia.org/wikipedia/commons/thumb/6/65/Lock-green.svg/9px-Lock-green.svg.png" style="height:14px; width:9px" title="Freely accessible" />. <a href="https://en.wikipedia.org/wiki/PubMed_Identifier" title="PubMed Identifier">PMID</a> <a href="https://www.ncbi.nlm.nih.gov/pubmed/11932250" rel="nofollow">11932250</a>.</cite></p>
<p>[[Biorxiv]]<em>5. </em>Altschul, SF; Gish, W; Miller, W; Myers, EW; Lipman, DJ (1990). "Basic local alignment search tool.". <em>Journal of Molecular Biology</em>. <strong>215</strong> (3): 403–10. <a href="https://en.wikipedia.org/wiki/Digital_object_identifier" title="Digital object identifier">doi</a>:<a href="https://dx.doi.org/10.1016%2FS0022-2836%2805%2980360-2" rel="nofollow">10.1016/S0022-2836(05)80360-2</a>. <a href="https://en.wikipedia.org/wiki/PubMed_Identifier" title="PubMed Identifier">PMID</a> <a href="https://www.ncbi.nlm.nih.gov/pubmed/2231712" rel="nofollow">2231712</a>.</p>
