comment6<p> </p> <p><strong>Obese in Genomics</strong></p> <p> </p> <p><strong>What is Obese?</strong></p> <div>-Obesity is a <a href="https://en.wikipedia.org/wiki/Medical_condition">medical condition</a> in which excess <a href="https://en.wikipedia.org/wiki/Body_fat">body fat</a> has accumulated to the extent that it may have a negative effect on health.</div> <div> </div> <div>-People are generally considered obese when their <a href="https://en.wikipedia.org/wiki/Body_mass_index">body mass index</a> (BMI), a measurement obtained by dividing a person's weight by the square of the person's height, is over 30 <a href="https://en.wikipedia.org/wiki/Kilogram">kg</a>/<a href="https://en.wikipedia.org/wiki/Square_metre">m</a><a href="https://en.wikipedia.org/wiki/Square_metre">2</a> , with the range 25–30 <a href="https://en.wikipedia.org/wiki/Kilogram">kg</a>/<a href="https://en.wikipedia.org/wiki/Square_metre">m</a><a href="https://en.wikipedia.org/wiki/Square_metre">2</a> defined as <a href="https://en.wikipedia.org/wiki/Overweight">overweight</a></div> <div> </div> <div>-Obesity increases the likelihood of <a href="https://en.wikipedia.org/wiki/Obesity-associated_morbidity">various diseases</a>, particularly <a href="https://en.wikipedia.org/wiki/Cardiovascular_diseases">heart disease</a>, <a href="https://en.wikipedia.org/wiki/Diabetes_mellitus_type_2">type 2 diabetes</a>, <a href="https://en.wikipedia.org/wiki/Obstructive_sleep_apnea">obstructive sleep apnea</a>, certain types of <a href="https://en.wikipedia.org/wiki/Cancer">cancer</a>, and <a href="https://en.wikipedia.org/wiki/Osteoarthritis">osteoarthritis</a>.</div> <div> </div> <div>-Obesity is most commonly caused by a combination of excessive <a href="https://en.wikipedia.org/wiki/Food_energy">food</a> intake, lack of physical activity, and <a href="https://en.wikipedia.org/wiki/Polygenic_inheritance">genetic susceptibility</a>.</div> <div> </div> <div><p> </p> <p><strong>Arrangement of basic terms in Genomics</strong></p> <p> </p> <p><strong>What is Genomics?</strong></p></div> <p>Genomics is the <a href="http://minajnakedpicsrbiopedia.livejournalorg/index.comphp/Omics">christina milian nudeomics</a>study of <a href="http://biopedia.org/index.php/Gene">genes</a> of individual organisms, 365058 populations, and <a href="http://madsennuderbiopedia.livejournalorg/index.comphp/Species">madonna nudespecies</a>.</p> <p>Paradigm of performing biological science that deviates from investigating single genes, qlwbultheir functions, and roles.</p> <p> </p> <p><strong>What is Omics?</strong></p> <p>General term for a broad discipline of science and engineering</p> <p>Analyzing the interactions of biological information objects in various <a href="http://angelinajolienacktsomics.freeforumsorg/index.php?title=Omes&action=edit">omes</a> in biology</p> <p><strong>Main focus</strong></p> <div>1)mapping information objects such as genes and proteins</div> <div><strong><u>2)finding interaction relationships among the objects</u></strong></div> <div>3)engineering the networks and objects to understand and manipulate the regulatory mechanisms</div> <div> </div> <div> </div> <div><strong>What is Proteomics?</strong></div> <div> </div> <div><p>Omics study of proteins, particularly their structures, sequences, and functions.</p> <p> (which proteins interact)</p> <p> </p> <p>The set of proteins produced by it during its life, and its genome is its set of genes.</p> <p> </p> <p>A proteome differs from cell to cell and constantly changes through its biochemical interactions with the genome and the environment.</p> <p>=> One organism has radically different protein expression in different parts of its body, different stages of its life cycle and different environmental conditions</p> <p>*There are far fewer protein-coding genes in the human genome than proteins in the human proteome (20,000 to 25,000 genes vs. > 500,000 proteins)</p> <p>=> Protein diversity is thought to be due to alternative splicing and post-translational modification of proteins</p> <p> </p> <p>New methods include protein microarrays, <u><strong>immunoaffinity chromatography followed by mass spectrometry(MALDI-TOF mass spectrometry),</strong> </u>and combinations of experimental methods such as phage display and computational methods.</p> <p> </p> <p><strong>What is Metabolome?</strong></p> <p> </p> <p>Interaction between an organism’s genome and its environment</p> <p> </p> <p>Complete set of <a href="https://en.wikipedia.org/wiki/Small_molecule">small-molecule</a> chemicals found within a biological sample.</p> <p> </p> <p>The <a href="https://en.wikipedia.org/wiki/Small_molecule">small molecule</a> chemicals found in a given metabolome may include both endogenous <a href="https://en.wikipedia.org/wiki/Metabolites">metabolites</a> that are naturally produced by an <a href="https://en.wikipedia.org/wiki/Organism">organism</a> as well as exogenous chemicals</p> <p> </p> <p><strong>The endogenous metabolome</strong></p> <p>-> primary metabolome</p> <p>-> Secondary metabolome</p> <p> </p> <p><a href="https://en.wikipedia.org/wiki/Primary_metabolite">* primary metabolite</a> is directly involved in the normal growth, development, and reproduction.</p> <p><a href="https://en.wikipedia.org/wiki/Secondary_metabolite">*secondary metabolite</a> is not directly involved in those processes, but usually has important ecological function(ex: <a href="https://en.wikipedia.org/wiki/Pigments">pigments</a>, <a href="https://en.wikipedia.org/wiki/Antibiotics">antibiotics</a> or waste products derived from partially metabolized <a href="https://en.wikipedia.org/wiki/Xenobiotics">xenobiotics</a>)</p> <p><a href="https://en.wikipedia.org/wiki/NMR_spectroscopy">Use NMR spectroscopy</a> and <a href="https://en.wikipedia.org/wiki/Mass_spectrometry">mass spectrometry</a>.</p> <p> </p> <p> </p> <p><strong>The Human Metabolome Database</strong></p> <p> </p> <p>Contain detailed data on more than 40,000 metabolites that have already been identified or are likely to be found in the human body</p> <p> </p> <div>1)Chemical information</div> <p>- includes >40,000 metabolite structures with detailed descriptions, extensive chemical classifications, synthesis information and observed/calculated chemical properties</p> <div> </div> <div>2)Clinical information</div> <p>- includes data on >10,000 <a href="https://en.wikipedia.org/wiki/Metabolite">metabolite</a>-<a href="https://en.wikipedia.org/wiki/Biofluid">biofluid</a> concentrations, metabolite concentration information on more than 600 different human diseases and pathway data for more than 200 different inborn errors of metabolism.</p> <div> </div> <div> </div> <div>3)Biochemical information.</div> <p>- includes nearly 6000 protein (and DNA) sequences and more than 5000 biochemical reactions that are linked to these metabolite entries</p></div> <p> </p> <p>---------------------------------------------</p> <p>Obese</p> <p> </p> <p>-> Mainly Influenced by External effects!</p> <p>-> The Disease that can be cured!</p> <p>-> Obese parents usually have obese children!</p> <p> </p> <p><strong><u>Therefore, Focus more on protemoics, Metabolome!</u></strong></p> <p> -----------------------------------------------------------------------</p> <p><strong><span style="font-size:14px">Adipose tissue</span></strong></p> <p> </p> <p><strong>-> Adipokine </strong></p> <p> -> <span style="font-size:12px"><span style="color:black; font-family:맑은 고딕">Adipose tissue secreted multiple mediator</span></span></p> <p><span style="font-size:12px"><span style="color:black; font-family:맑은 고딕"> </span></span>-> Passed through either endocrine or paracrine</p> <p> Ex: Hormone: leptin, adiponectin</p> <p> </p> <p><strong>-> Adiponectin</strong></p> <p><strong> -> </strong>Adipocyte-secreted adipokine</p> <p> -> Increase lipid oxidation& anti-inflammatory, insulin-sensitizing, angiogenic action</p> <p> <strong>=> Anti obesity & Antidiabetic, Decrease insulin resistance </strong></p> <p> [[File:1.png|400px]]</p> <p> </p> <p> </p> <p> [[File:2.gif|400px]]</p> <p>-> Illustration of the major physiological and metabolic</p> <p>processes with which adipose tissue is involved through the secretion</p> <p>of various adipokines from adipocytes. The interactions may be</p> <p>autocrine, paracrine, or endocrine.</p> <p> </p> <p><span style="font-size:16px">angelina jolie nackt<strong><Searching Scientific Reports></strong></span></p> <p> [[File:3.png|400px]]</p> <p> [[File:4.png|400px]]</p> <p> </p> <p><strong><span style="font-size:16px"><What is Col6?></span></strong></p> <p>- COL6 = Collagen type 6</p> <p>- Abundant constituent of white adipose tissue (WAT)</p> <p>- COL6 levels positively correlate with hyperglycaemia and insulin resistance</p> <p>- Composed of three distinct a chains, a1, a2 and a3.(COL6 trimeric building block) and are subsequently secreted into the ECM</p> <p> </p> <p><strong><span style="font-size:16px"><What is a3 Chain?></span></strong></p> <p>-> longest of the three chains</p> <p>- contains an unusually long N terminus and aglobular C5 domain at the C-terminus</p> <p> </p> <p>-> C-terminal portion of the a3 subunit is cleaved off during the post-translational processing of COL6 fibrils(COL6a3, %Endotrophin)</p> <p> </p> <p><strong><span style="font-size:16px"><What is Endotrophin?></span></strong></p> <p>- Adipokine with potent tumour-promoting effects</p> <p>- Plays a pivotal role in shaping a metabolically unfavorable microenvironment in adipose tissue during consumption of a high-fat diet (HFD)</p> <p>- Powerful co-stimulator of pathologically relevant pathways within the ‘unhealthy’ adipose tissue milieu,triggering fibrosis and inflammation and ultimately leading to enhanced insulin resistance& metabolic dysfunction.</p> <p>- Exerts a major influence in adipose tissue</p> <p>- Endotrophin within the tumor microenvironment serves as a major mediator of COL6-stimulated mammary tumor growth and subsequent chemo resistance</p> <p>- Stimulates fibrosis, activates endothelial cell migration and promotes macrophage infiltration into growing solid tumors.</p> <p>=> elevated mammary tumor expansion and more pronounced metastatic growth</p> <p> [[File:5.png|400px]]</p> <p>---------------------------------------------------------</p> <p><u><strong><span style="font-size:18px">Problem!</span></strong></u></p> <p> </p> <p><strong>-> Don’t know the mechanism of how ETP works.</strong></p> <p> </p> <p><u><strong><span style="font-size:16px">What I’m going to do!</span></strong></u></p> <p> </p> <div><strong>-> Find the Receptor according to the New method of Protemoics.</strong></div> <div><strong>-> Find the interaction, relationship and mechanisms how they act.(Study of Omics)</strong></div> <div><u><strong> -> Omics could be applied to genomics perspective!</strong></u></div> <p> </p> <p> </p> <p>mETP(204bp, 16.43kda)</p> <p>ACAGAACCATTGTTTCTCACTAAAACAGATATATGTAAGCTGTCCAGAGATGCTGGGACTT</p> <p>GTGTGGACTTCAAGTTACTATGGCACTATGACCTAGAGAGCAAAAGTTGCAAGAGATTCTG</p> <p>GTATGGAGGTTGTGGAGGCAACGAGAACAGATTCCACTCCCAGGAAGAATGTGAAAAGATGTGTAGTCCTGAGTTAACAGTT</p> <p> </p> <p>SpyTag(39bp, 16.43kda)</p> <p>GCCCACATCGTGATGGTGGACGCCTACAAGCCGACGAAG</p> <p> </p> <p>pRL(90bp, 7.48kda)</p> <p>ATGGACAGCAAAGGTTCGTCGCAGAAAGGGTCCCGCCTGCTCCTGCTGCTGGTGGTGTCAAATCTACTCTTGTGCCAGGGTGTGGTCTCC</p> <p> </p> <p>(1)</p> <p> [[File:12.png|600px]]</p> <p> pRA-GFP-EcoR1-pRL-unknown-mETP-SpyTag-Stop</p> <p> </p> <p>-><strong> How to make this cloning?</strong></p> <p>(1)By Using pRL-EcoR1 forward primer, mETP-SpyTag-Stop-Xho1 primer, make pRL-EcoR1-mETP-SpyTag-Stop-Xho1 by Ex-Tag PCR</p> <p>[[File:13.png|500px]]</p> <p>(2) Insert template gained from (1) in T-Vector to check whether it is really pRL-EcoR1-mETP-SpyTag-Stop-Xho1 or not.</p> <p>(3) Use EcoR1, Xho1 Digestion enzyme to double digest T vector</p> <p>(4) Double Digest pRA GFP vector(empty vector) and purify it.</p> <p>(5) ligate (3), (4) product</p> <p> </p> <p><strong>-> Detailed on Each Steps</strong></p> <p>(1) Ex-Tag PCR process</p> <p> </p> <p>->Template(pRA-GFP, 20ng): 1ul</p> <p>->Primer: 1,1ul</p> <p>->dNTP(10nM): 1ul</p> <p>->10X Ex-Tag Buffer: 2.5ul</p> <p>-> Ex-Tag polymerase: 1ul</p> <p>-> D.W: 17.5ul</p> <p>----------------------------------------</p> <p>Total: 25ul</p> <p> </p> <p>PCR</p> <p>->Temperature Gradient : 54,56,58</p> <p>->98 celsius : 2min</p> <p>->98 celsius : 10sec</p> <p>->57 celsius : 30sec</p> <p>->72 celsius : 30sec(insert 300bp)</p> <p>->72 celsius : 5min</p> <p>X35</p> <p> [[File:14.png|400px]]</p> <p>-> Can see the insert(300bp) in both 54,56,58 temperature gradient!</p> <p> </p> <p> (2)</p> <p><T vector ligation></p> <p>Insert DNA mass: 8.607ng(3:1)</p> <p>2X Rapid ligation: 5ul</p> <p>T vector: 0.5ul(25ng)</p> <p>PCR product: 1ul(8.7ng)</p> <p>D.W: 2.5ul</p> <p>T4 DNA Ligase: 1ul</p> <p>----------------------------</p> <p>Total: 10ul</p> <p>RT 1 hour incubation</p> <p>Then, Transformation</p> <p> </p> <p><Colony PCR></p> <p>-> Check whether insert base pairs is inserted in T vector well</p> <p>T.D.W : 14.9</p> <p>10X Buffer : 2</p> <p>M13 primer Forward: 0.5</p> <p>M13 primer Reverse: 0.5</p> <p>2.5mM dNTP: 1.6</p> <p>XL-Taq polymerase: 0.5</p> <p> ---------------------------------</p> <p>[[File:15.jpg|400px]]</p> <p>Can check on 3,5 well(T vector 200bp+ 346bp = 500~600bp)</p> <p> </p> <p> (3)</p> <p> </p> <p> </p> <p>------------------------------------------------------------</p> <p>[[20131571 조우빈]]</p>