Changes

Scientific Experiment

14,232 bytes added, 16:23, 4 November 2016

no edit summary

~~BiO Centre or BiO Center~~   Obese in Genomics   What is Obese? <div>-Obesity is a <a href="https://en.wikipedia.org/wiki/Medical_condition">medical condition</a> in which excess <a href="https://en.wikipedia.org/wiki/Body_fat">body fat</a> has accumulated to the extent that it may have a negative effect on health.</div> <div> </div> <div>-People are generally considered obese when their <a href="https://en.wikipedia.org/wiki/Body_mass_index">body mass index</a> (BMI), a measurement obtained by dividing a person's weight by the square of the person's height, is over 30 <a href="https://en.wikipedia.org/wiki/Kilogram">kg</a>/<a href="https://en.wikipedia.org/wiki/Square_metre">m</a><a href="https://en.wikipedia.org/wiki/Square_metre">2</a> , with the range 25–30 <a href="https://en.wikipedia.org/wiki/Kilogram">kg</a>/<a href="https://en.wikipedia.org/wiki/Square_metre">m</a><a href="https://en.wikipedia.org/wiki/Square_metre">2</a> defined as <a href="https://en.wikipedia.org/wiki/Overweight">overweight</a></div> <div> </div> <div>-Obesity increases the likelihood of <a href="https://en.wikipedia.org/wiki/Obesity-associated_morbidity">various diseases</a>, particularly <a href="https://en.wikipedia.org/wiki/Cardiovascular_diseases">heart disease</a>, <a href="https://en.wikipedia.org/wiki/Diabetes_mellitus_type_2">type 2 diabetes</a>, <a href="https://en.wikipedia.org/wiki/Obstructive_sleep_apnea">obstructive sleep apnea</a>, certain types of <a href="https://en.wikipedia.org/wiki/Cancer">cancer</a>, and <a href="https://en.wikipedia.org/wiki/Osteoarthritis">osteoarthritis</a>.</div> <div> </div> <div>-Obesity is most commonly caused by a combination of excessive <a href="https://en.wikipedia.org/wiki/Food_energy">food</a ~~openfree community~~ > intake, lack of ~~scientists~~ physical activity, and ~~philosopher~~<a href="https://en.wikipedia.org/wiki/Polygenic_inheritance">genetic susceptibility</a>. <div>  [<div>  Arrangement of basic terms in Genomics   What is Genomics?</div> Genomics is the <a href="http://biopedia.org/index.php/Omics">omics</a> study of <a href="http://biopedia.org/index.php/Gene">genes</a> of individual organisms, populations, and <a href="http://~~biocentre~~biopedia.org ~~Biocentre~~/index.php/Species">species</a>. Paradigm of performing biological science that deviates from investigating single genes, their functions, and roles.   What is Omics? General term for a broad discipline of science and engineering Analyzing the interactions of biological information objects in various <a href="http://omics.org/index.php?title=Omes&action=edit">omes</a> in biology Main focus <div>1)mapping information objects such as genes and proteins</div> <div>2)finding interaction relationships among the objects</div> <div>3)engineering the networks and objects to understand and manipulate the regulatory mechanisms</div> <div> </div> <div> </div> <div>What is Proteomics?</div> <div> </div> <div>Omics study of proteins, particularly their structures, sequences, and functions.    (which proteins interact)   The set of proteins produced by it during its life, and its genome is its set of genes.   A proteome differs from cell to cell and constantly changes through its biochemical interactions with the genome and the environment. => One organism has radically different protein expression in different parts of its body, different stages of its life cycle and different environmental conditions *There are far fewer protein-coding genes in the human genome than proteins in the human proteome (20,000 to 25,000 genes vs. > 500,000 proteins) => Protein diversity is thought to be due to alternative splicing and post-translational modification of proteins   New methods include protein microarrays, immunoaffinity chromatography followed by mass spectrometry(MALDI-TOF mass spectrometry), and combinations of experimental methods such as phage display and computational methods.   What is Metabolome?   Interaction between an organism’s genome and its environment   Complete set of <a href="https://en.wikipedia.org/wiki/Small_molecule">small-molecule</a> chemicals found within a biological sample.   The <a href="https://en.wikipedia.org/wiki/Small_molecule">small molecule</a> chemicals found in a given metabolome may include both endogenous <a href="https://en.wikipedia.org/wiki/Metabolites">metabolites</a> that are naturally produced by an <a href="https://en.wikipedia.org/wiki/Organism">organism</a> as well as exogenous chemicals   The endogenous metabolome -> primary metabolome -> Secondary metabolome   <a href="https://en.wikipedia.org/wiki/Primary_metabolite">* primary metabolite</a> is directly involved in the normal growth, development, and reproduction. <a href="https://en.wikipedia.org/wiki/Secondary_metabolite">*secondary metabolite</a> is not directly involved in those processes, but usually has important ecological function(ex: <a href="https://en.wikipedia.org/wiki/Pigments">pigments</a>, <a href="https://en.wikipedia.org/wiki/Antibiotics">antibiotics</a> or waste products derived from partially metabolized <a href="https://en.wikipedia.org/wiki/Xenobiotics">xenobiotics</a>) <a href="https://en.wikipedia.org/wiki/NMR_spectroscopy">Use NMR spectroscopy</a> and <a href="https://en.wikipedia.org/wiki/Mass_spectrometry">mass spectrometry</a>.     The Human Metabolome Database   Contain detailed data on more than 40,000 metabolites that have already been identified or are likely to be found in the human body   <div>1)Chemical information</div> - includes >40,000 metabolite structures with detailed descriptions, extensive chemical classifications, synthesis information and observed/calculated chemical properties <div> </div> <div>2)Clinical information</div> - includes data on >10,000 <a href="https://en.wikipedia.org/wiki/Metabolite">metabolite</a>-<a href="https://en.wikipedia.org/wiki/Biofluid">biofluid</a> concentrations, metabolite concentration information on more than 600 different human diseases and pathway data for more than 200 different inborn errors of metabolism. <div> </div> <div> </div> <div>3)Biochemical information.</div> - includes nearly 6000 protein (and DNA) sequences and more than 5000 biochemical reactions that are linked to these metabolite entries</div>   --------------------------------------------- Obese   -> Mainly Influenced by External effects! -> The Disease that can be cured! -> Obese parents usually have obese children!   Therefore, Focus more on protemoics, Metabolome!  ----------------------------------------------------------------------- Adipose tissue   -> Adipokine    -> Adipose tissue secreted multiple mediator    -> Passed through either endocrine or paracrine        Ex: Hormone: leptin, adiponectin   -> Adiponectin     -> Adipocyte-secreted adipokine     -> Increase lipid oxidation& anti-inflammatory, insulin-sensitizing,  angiogenic action     => Anti obesity & Antidiabetic, Decrease insulin resistance   [[File:1.png|400px]]      [[File:2.gif|400px]] -> Illustration of the major physiological and metabolic processes with which adipose tissue is involved through the secretion of various adipokines from adipocytes. The interactions may be autocrine, paracrine, or endocrine.   <Searching Scientific Reports>  [[File:3.png|400px]]  [[File:4.png|400px]]   <What is Col6?> - COL6 = Collagen type 6 - Abundant constituent of white adipose tissue (WAT) - COL6 levels positively correlate with hyperglycaemia and insulin resistance - Composed of three distinct a chains, a1, a2 and a3.(COL6 trimeric building block) and are subsequently secreted into the ECM   <What is a3 Chain?> -> longest of the three chains - contains an unusually long N terminus and a globular C5 domain at the C-terminus   -> C-terminal portion of the a3 subunit is cleaved off during the post-translational processing of COL6 fibrils(COL6a3, Endotrophin)   <What is Endotrophin?> - Adipokine with potent tumour-promoting effects - Plays a pivotal role in shaping a metabolically unfavorable microenvironment in adipose tissue during consumption of a high-fat diet (HFD) - Powerful co-stimulator of pathologically relevant pathways within the ‘unhealthy’ adipose tissue milieu, triggering fibrosis and inflammation and ultimately leading to enhanced insulin resistance& metabolic dysfunction. - Exerts a major influence in adipose tissue - Endotrophin within the tumor microenvironment serves as a major mediator of COL6-stimulated mammary tumor growth and subsequent chemo resistance - Stimulates fibrosis, activates endothelial cell migration and promotes macrophage infiltration into growing solid tumors. => elevated mammary tumor expansion and more pronounced metastatic growth  [[File:5.png|400px]] --------------------------------------------------------- Problem!   -> Don’t know the mechanism of how ETP works.   What I’m going to do!   <div>-> Find the Receptor according to the New method of Protemoics.</div> <div>-> Find the interaction, relationship and mechanisms how they act.(Study of Omics)</div> <div> -> Omics could be applied to genomics perspective!</div>     mETP(204bp, 16.43kda) ACAGAACCATTGTTTCTCACTAAAACAGATATATGTAAGCTGTCCAGAGATGCTGGGACTT GTGTGGACTTCAAGTTACTATGGCACTATGACCTAGAGAGCAAAAGTTGCAAGAGATTCTG GTATGGAGGTTGTGGAGGCAACGAGAACAGATTCCACTCCCAGGAAGAATGTGAAAAGATGTGTAGTCCTGAGTTAACAGTT   SpyTag(39bp, 16.43kda) GCCCACATCGTGATGGTGGACGCCTACAAGCCGACGAAG   pRL(90bp, 7.48kda) ATGGACAGCAAAGGTTCGTCGCAGAAAGGGTCCCGCCTGCTCCTGCTGCTGGTGGTGTCAAATCTACTCTTGTGCCAGGGTGTGGTCTCC   (1)  [[File:12.png|600px]]  pRA-GFP-EcoR1-pRL-unknown-mETP-SpyTag-Stop   -> How to make this cloning? (1)By Using pRL-EcoR1 forward primer, mETP-SpyTag-Stop-Xho1 primer, make pRL-EcoR1-mETP-SpyTag-Stop-Xho1 by Ex-Tag PCR [[File:13.png|500px]] (2) Insert template gained from (1) in T-Vector to check whether it is really pRL-EcoR1-mETP-SpyTag-Stop-Xho1 or not. (3) Use EcoR1, Xho1 Digestion enzyme to double digest T vector (4) Double Digest pRA GFP vector(empty vector) and purify it. (5) ligate (3), (4) product   -> Detailed on Each Steps (1) Ex-Tag PCR process   ->Template(pRA-GFP, 20ng): 1ul ->Primer: 1,1ul ->dNTP(10nM): 1ul ->10X Ex-Tag Buffer: 2.5ul -> Ex-Tag polymerase: 1ul -> D.W: 17.5ul ---------------------------------------- Total: 25ul   PCR ->Temperature Gradient : 54,56,58 ->98 celsius : 2min ->98 celsius : 10sec ->57 celsius : 30sec ->72 celsius : 30sec(insert 300bp) ->72 celsius : 5min X35  [[File:14.png|400px]] -> Can see the insert(300bp) in both 54,56,58 temperature gradient!    (2) <T vector ligation> Insert DNA mass: 8.607ng(3:1) 2X Rapid ligation: 5ul T vector: 0.5ul(25ng) PCR product: 1ul(8.7ng) D.W: 2.5ul T4 DNA Ligase: 1ul ---------------------------- Total: 10ul RT 1 hour incubation Then, Transformation   <Colony PCR> -> Check whether insert base pairs is inserted in T vector well T.D.W : 14.9 10X Buffer : 2 M13 primer Forward: 0.5 M13 primer Reverse: 0.5 2.5mM dNTP: 1.6 XL-Taq polymerase: 0.5  --------------------------------- [[File:15.jpg|400px]] Can check on 3,5 well(T vector 200bp+ 346bp = 500~600bp)    (3)     ------------------------------------------------------------ [[20131571 조우빈]]

Anonymous user

imported>조우빈

Changes

Scientific Experiment

Navigation menu

Views

Personal tools

Search

Navigation

Advertisements

Tools

Related Links[Edit]